How can I find the cracked version of ENVI-met software?

Abeeha Nadeem @Abeeha-Nadeem

08 August 2024 1 8K Report

Envi-met software

Carl Alexander Frisk

Please refrain from illegal activities. Request a licence from your university research/IT department.

Badges
Science topic

Similar topics
Filing

More Abeeha Nadeem's questions See All

Entropy measure and QSPR modeling in Graph Theor. How to construct the table for lengthy equation?

The entropy measured of molecular graphs plays a crucial rule. The network structures in some cases are very lengthy calculations to handle. Some author avoid to construct table where as most...

30 July 2024 3,126 0 View

Critique Calculaltion in Topological Indices and QSPR Modeling?

The first step is to analyze a 2D molecular graph and implement partitioning techniques to calculate the topological indices. Secondly impose statically tools to generate QSPR model, may or may...

24 July 2024 9,644 1 View

What strategy should be adopted to calculate topological indices efficiently?

Most of the time it is observed that in many manuscripts there are several typo error of topological calculation errors of calculation and partition of edges what ever the type of partitioning it...

22 July 2024 811 0 View

Nicotiana benthamiana seeds sterilization methods for tissue culturing?

I have been trying to grow Nicotiana benthamiana via tissue culture. I used ethanol and sodium hypochlorite with different concentrations and time duration for seeds sterilization and lastly...

18 June 2024 1,756 3 View

If Concentration of DNA is 85ng/ul then calculate its concentration for 50ul reaction using Phusion Flash Master Mix?

can any budy explain how i calculate the DNA concentration for the 50ul reaction?

22 May 2024 9,557 1 View

If the sequence of the primers are given and size of the PCR product is 2500 then what will be the PCR profile for the given reaction?

If the sequence of the primers are given as: Forward: ATATAGACCAATATTCCTGTTAGCA, Reverse: AAAAATTAGCCGGGCGTAGTGGCG and size of the PCR product is 2500bp, then what will be the PCR profile for the...

22 May 2024 7,777 1 View

QSPR model is not fit for or it does not deliberate best answers. How we can improve it?

The QSPR analysis some time fails to produce relevant answer. what we should do to get improve results.

29 August 2023 7,764 2 View

What the difference exists between the QSPR analysis by using 2D and 3D model of drugs structures?

Where as some authors use 2d model and other use 3d model. How we can distinguish what the difference. Are the results same or different?

27 August 2023 552 2 View

How to establish a Mathematical Model on "Transfer of heat in human body organs"?

I'm looking for a mathematical model for transfer of heat in human body organs especially (eye, heart, brain and lungs). How is the behavior of heat transfer at normal and extreme levels

12 July 2023 4,888 2 View

What will be the data inputs and methodology related to LCA and LCC analysis of hydroponics using reclaimed water?

can anyone guide me that what are the key data inputs, methodology, and software recommended for conducting an assessment of the financial viability and sustainability of hydroponics using...

17 June 2023 1,496 0 View

Envi-met deletes the model's buildings when adding cells to the top of the model?

Hello everyone I have a model of an area of Lisbon designed on Envi-met but the top of the model is close to the top of the buildings. When I try to add cells to the top of the model the program...

10 June 2024 3,556 0 View

Call for Chapters: Applying Remote Sensing and GIS?

Call for Chapters: Applying Remote Sensing and GIS for Spatial Analysis and Decision-Making. No fees for manuscripts. Published by IGI Global...

10 April 2024 474 0 View

How to compare the USGS spectral library with MNF data in hyperspectral image techniques using ENVI software?

In pre-processing, when transforming hyperspectral data to a Minimum Noise Function(MNF) data, the dimensionality will reduce and at the same time the wavelength information will loose. B'z MNF...

26 February 2024 8,059 6 View

Opening Landsat images in ENVI Classic?

How can I solve ENVI 5.3 problem with new landsat products to open Geotiff in ENVI classic? ENVI Classic asks about the number of samples and number of lines and number of Bands to open the...

25 December 2023 6,851 0 View

It gives me the following error "$$ ENVI-met has replaced 128086 invalid profiles in configuration. ". Does anyone know how to give it a solution?

hello everyone. When performing the Envi-met check.

14 December 2023 2,484 1 View

How to pre process and work with AVIRIS data for mineral target?

Hi, currently im using ENVI to work with AVIRIS data located in Sonora, México. Anyone that knows how to perform a spectral analysis for locating mineral data? I don´t have spectral field data of...

15 September 2023 3,438 0 View

"envi-met has replaced 9 invalid profiles in configuration" is that a problem?

"Envi-met has replaced 9 invalid profiles in configuration" is that a problem? and it take a long time

03 September 2023 8,054 1 View

Why ENVI's Radiometric Calibration tool is not displaying?

Hi, I am trying to perform a radiometric calibration of an Aster image on ENVI, I watched a youtube tutorial where they use the Radiometric calibration tool, but when I tried to do it on my...

19 July 2023 4,350 2 View

How do i can insert the sentinel 2 imagery in the ENVI software?

09 May 2023 6,486 0 View

Envi-met: How to access Building material (Wall and Roof), created in Envimet Database, in Spaces?

For Explanation: I duplicated few materials in Envimet database and changed few associated properties and saved under user defined materials (database). I created a building model in sketchup and...

30 April 2023 7,189 1 View