There must have been some problem with the software or methods used to build your multiple sequence alignment.  But without details of which software, and methods you used, we could only guess at what the problem was.  I have an alignment of the DNA polymerase gene from a variety of poxviruses, so I will attach it for you here.

Please provide more information about what software or website you used to perform the alignment.  Generally speaking, alignment tools will add gaps where necessary but will not delete nucleotides.  Including your pre-alignment and post-alignment files would be helpful.

Thanks for interest, I have been used MEGA 6.0 software,

see attached file

The sequences labeled as ORF1, ORF2, ORF3 and ORF4 do not seem to be sheep pox or ORF virus, they have very little similarity to the KC511810 sequence, while dozens of other GenBank entries for ORF virus and Pseudocowpox virus are highly similar to KC511810.  You sent an image of the sequences, rather than actual text, so it is not easy for us to give you more help figuring out what your sequences are.  For example, is it possible they are the reverse complement of the KC511810 sequence?

I recreated the last line of your sequence, and used BLAST, to find that it is indeed ORF virus, but the reverse complement of the sequence with accession number KC51180

Your sequence

CGGAAGGTCATGTCGTTGTCGACCACCAGGATGAAGTCATCGTCGGAGTACTT

ORF Virus

CGGAAGGTCATGTCGTTGTCGACCACCAGGATGAAGTCATCGTCGGAGTACTT

bases 179 - 127 reverse comlement

Thanks for the clarify Dr.Brian Thomas Foley