How much laddering? (from 500 bp to..?)

I'd suggest to redesign primers, if possible. The first two for exaple end with TCA. It is usually preferable to end with C and/or G. Then do you know if there are repetitive sequences? or similar? In order to reduce mispriming you should raise annealing temperature. 62 it's high in my opinion but you could try up to 65.

try lowering the temperature and increase the time of your circles. Are you sure that your primers are correct targeting vector DNA?

I think the anneling temperature is too high please try somewhere between 54-55. I think this will help you.

35 cycles

94 for 3 min

94 for 30s

54-55 for 40s

72 for 30 s

72 for 10min

Just try this

All the best.

The DNA concentration would be another important issue, have you checked the DNA template by 260/280 absorbance assay?... A huge quantity of DNA in samples could be related with laddering results in some cases!

It is frustrating and usually no good explanation. The price for primers is low and I will suggest to design other primers for your PCR. Also, lower down the cDNA concentration is not a bad idea to try. Did you see laddering when you put ddH2O instead of sample? If laddering also appear with ddH2O then self annealing of primers may be the cause.

thank you all for ur suggestions. These sets of primers were for GMO detection in food commodities and suggested by ISO methods,

1st one is to detect CaMV 35s promoter and 2nd one is to detect Napoline synthase NOS terminator sequences which would be used usually for GM of many traits.

I suspected the oligos I have used so far, I cant be sure if there could be any other major reason creating this problem.

just now I made reaction mix including 2% DMSO assuming its help.

Is your template dna okay or degrated? Check this by loading dna on a gel start running. Intact plasmid dna should have 3 bands (one major, 2 weak bands). Genomic dna should not smear in gel. Check this.

Furthermore play around with annealing temperature. Maybe run a gradient pcr for determination of optimal annealing temperature.

Are the indicated primers cloning primers? Or just primers where you want to look whether something is present or not? Maybe design new primers which are more specific.

Good luck!

Thanks Mr. Arvind Goyal I will set my next PCR with specified thermal profile by u.

laddering effect starting at around 500bp and continues to below 100bp on gel (2% agarose)

This is making me totally mad.

the templates are genomic DNAs of Maize and Soybean which are suitable for standard PCR as I checked them on Biodrop.

and for positive and negative controls I used GMO rice (LL rice) and non modified rice genomic DNA purchased from AOCS

Water I used is from cascada Bio water filtration unit, I feel which is equivalent to MB grade water available from many companies.

Ru-Jeng Teng, yes I kept a No DNA Control with just water instead of any DNA, that also resulted to the same laddering effect.

As I read in many publications suggesting the use of DMSO to avoid secondary structures of DNA or an oligo, if the real problem for this laddering effect is due to oligos I used. Do u feel using the DMSO will help me in avoiding this and make me smile atleast.

DNA is Ok on gel, and primers are to detect specific sequences producing specific bands Manuel Otte

okay than try DMSO (personally I use 3%DMSO final conc.). and maybe run gradient PCR to determine a better annealing temperature.

Hi there,

I would start checking the quality and quantity of your DNA. How did you extracted your DNA?

The Tannealing seems a bit high to me, I would start around 55 C and then work around it about 2 degrees. I would also decrease the temperature of the initial denaturation step. (I usually use 94 degrees for 1 minute)

I hope this can be helpful, let me know how it is going.

Best,Ema

I will second the addition of DMSO (successfully helps up to 10% in my experience). This will allow you to lower the annealing temp as well.

I would recommend using your current temp with a range of DMSO concentrations as a starting point.

thanks for suggestions after using DMSO with same cycling conditions I did not get any specific band though the so called laddering effect was disappeared almost.

Anyway Please have a look on these gel images from my previous PCRs showing the smears and ladders in products

Second one

Check your dna concentration. At this point I could run the pcr with reduced dna concentration.

Suggestion 1: based on your second one and then reduce DNA (optional), increase anneling temperature to 65.

Suggestion 2: to use Phusion High Fidelity PCR or other Phusion PCR system.

Good Luck

Hi, I think that your primers are not well designed, try the web page of Primer 3:

http://bioinfo.ut.ee/primer3-0.4.0/.

Before to do the experiment you need to check self dimers and hairpins, also the PCR in silico, for this point there are a few web sites as:

https://www.idtdna.com/analyzer/Applications/OligoAnalyzer/

http://www.basic.northwestern.edu/biotools/oligocalc.html

good luck

Apart from primer design that is not optimal, but also not too bad (hairpin or not: normally it works somehow) , your results may hint towards repetitive DNA elements in your target DNA; maybe even your primers are derived from repetitive parts. In that case, what you call unspecific" is an an unavoidable result of your expreriment.

I am also not sure, with respect to your smear-gel that indeed the primers do the intended priming. This looks for me more like a DNA preparation that contains a lot of small fragments. These will of course also prime during amplification.

Please decrease the concentration of template DNA and try adding glycerol at 10% concentration....it will be good enough

This is the gel image of DNAs from 10 different samples isolated at a time, I see no fragmentation of isolated DNA in this.

Is there a possibility that the fragmentation may happen during the freeze thaw of DNAs during PCR setup?

For a PCR reaction,,, you require as low as 1-10 ng of DNA which is not visible on gel...so if fragmentation occurs during PCR, its not going to show up on gel. Laddering is due to non-specific product formation due to high template concentration in your reaction mix or low specificity of the primers or low annealing temperature. Specificity can be increased by adding glycerol as I mentioned earlier and by increasing the annealing temp. Surely decrease the amount of template..Hope it helps..

Chek the follwing points

Regarding multiple band

1. Specificity of primer? Have you blast your primer against genome seq of organism from which you isolated DAN, provided seq available (use http://genome.ucsc.edu/).

2. Possibility of Genomic DNA contamination, even small amount of DNA may give nonspecific band, dilute of template

Regarding smearing of Band

1. Possibility of DNAse contamination in reagent use fresh vial

2. Play with conc of primers

If you get desire band in mix band, than perform re-PCR from diluted PCR product

First of all looking at your DNA Gel PIc. The DNA is OK but has to be diluted at least 10 times (rough estimate) Then do PCR. I have certain doubts. Have you designated the Primers your self? If so how?

If you are using primers developed by someone and finding difficulty in getting results then use touch down pcr

First,

did you changed your water?

Second,

your primer second is quite palindromic and GC rich at 3'end,is there a possibility to look into the sequence again for redesigning it,if with this primer pair desired amplicon always failed

Ome reason may be the concentration of primers. dilute stock primer to 1/2 not 1/10.

Ok

Never freeze-thaw DNA if you can avoid it. DNA is stable for months at 4C and for decades at -20C, but freeze-thawing is notorious for damaging it. It's much better to aliquot your DNA and freeze it, then take out tubes, thaw them once and store them in the fridge until you're finished with them.

what is size of product you want to amplify and do you have any idea about its complexity

i analyze your primer and here is some suggestion

1) Design new primer

2) If not possible to design new primer change your annealing temprature from 62 to app 55

3) Perform some optimization step like Mg titration PCR

Do you know how your template is organised?

Aren't there suppossed to be 2 fragments?

Because, if you just BLAST your primers there areseveral constructs in which they bind twice:

Gossypium hirsutum transgenic line MON15985 promoter region

Sequence ID: gb|KJ608138.1|Length: 610Number of Matches: 3

Related Information

Range 1: 537 to 556GenBankGraphics Next Match Previous Match

Alignment statistics for match #1 Score Expect Identities Gaps Strand

40.1 bits(20) 0.93 20/20(100%) 0/20(0%) Plus/Minus

Query 20 GATAGTGGGATTGTGCGTCA 39

||||||||||||||||||||

Sbjct 556 GATAGTGGGATTGTGCGTCA 537

Range 2: 101 to 119GenBankGraphics Next Match Previous Match First Match

Alignment statistics for match #2 Score Expect Identities Gaps Strand

38.2 bits(19) 3.7 19/19(100%) 0/19(0%) Plus/Plus

Query 1 GCTCCTACAAATGCCATCA 19

|||||||||||||||||||

Sbjct 101 GCTCCTACAAATGCCATCA 119

Range 3: 362 to 380GenBankGraphics Next Match Previous Match First Match

Alignment statistics for match #3 Score Expect Identities Gaps Strand

38.2 bits(19) 3.7 19/19(100%) 0/19(0%) Plus/Plus

Query 1 GCTCCTACAAATGCCATCA 19

|||||||||||||||||||

Sbjct 362 GCTCCTACAAATGCCATCA 380

Possibly you have a double 35S in your template. I don't know which size marker you used, are the fragments about 456 and 200 bp? (MAybe not they seem to be a bit to close together)

i am also face the same problem with transgenic maize genomic DNA. the primers used for PCR are specific and checked by multiple tools like primer stat, IDT, it gives two bands with phire hot start taq one at required bp 1500 and 2nd little higher 2500 bp. the other taq enzymes didnt produce any bands. some time smears as u seen in 2nd gel pic.

Please post gel images of amplicons by two different taq enzymes.

Image 0521 is with phire taq enzyme. PCR profile 98, 5 min, 98 , 15s, 64, 20 sec, 72, 1m  35 cycles 72 , 5 m  4c. used 0.4 ul of phire taq enzyme. 3 ul DNA ( conc. 25ng/ul)

Mr. Abdul,

Please upload a gel image got with taq enzyme other than Phire taq. u mean no band by clear gel with out a primer dimer even at the bottom?

Mr Lakshmi Narayana Lavu:  Yes primer dimmers at end but rest is clear.

Hi,

You may need to adjust the annealing conditions for your primers with routine taq. These modified taq enzymes like Phire taq have different activity than normal taq enzyme and robust performance. Please refer and select any of the manufacturer's selection guide based on your target specifications.