Can you Suggest any institute that provides hands on training on NGS data analysis in India?

I am interested in attending a training session on NGS data analysis.

02 March 2019 5,657 2 View

Taqman probe PCR is failing to give fluorescence in qPCR. While the product is being amplified after cycling of same. Why?

Dear All,I hope everyone is doing good. I got 2 sets of primers and probes for a duplex PCR to screen for CamVP35 promoter region and Nos Terminator region detection. (I attached an excel...

11 December 2014 3,459 5 View

Is anyone familiar with BHQ1 modified probe solution?

11 December 2014 5,925 0 View

Can I replace the reporter dye without changing the probe sequence?

Hi, As a beginner of this I wanted to be clear about few things regarding fluorescent probes and their dyes. In one published document I selected below two probes for a duplex qPCR 1)....

10 November 2014 1,091 8 View

What is the most accurate way to quantify DNA?

Hi all, I have been using UV spectrometery for DNA quantification. Where is it limited to use within a certain OD range, though I get reliable repeatability with that. It doesn't support the...

10 November 2014 2,454 19 View

Multiple bands and laddering effect on agarose gel - any thoughts?

07 August 2014 1,269 10 View

Can anyone suggest the primers for detecting fish species (to cover the detection of most of the fish species)?

To investigate the adulteration of meat.

05 June 2014 4,756 5 View

What should be done if my pcr products are giving laddering effect even after altering the annealing temp. & using fresh aliquotes of every component?

1F- GCTCCTACAAATGCCATCA 1R- GATAGTGGGATTGTGCGTCA 2F- GCATGACGTTATTTATGAGATGGG 2R- GACACCGCGCGCGATAATTTATCC are the primers came with dst purification from sigma and taq dna polymerase from sigma...

04 May 2014 3,154 36 View

How does the hairpin formation of oligos effect the PCR in yielding specific product?

If my primer is able to form hairpin at an end, and causes non specific bands, how can I overcome this effect practically? Please suggest a way to avoid this without altering the primer base pair...

04 May 2014 5,290 6 View

Binary Logistic Generalized Linear Mixed model in SPSS. Is it doable?

I want to analyses the proportion of swimming sperm of three species of fish in two salinities. To analyse the proportion of swimming sperm in a Generalized Linear Model, I would use a Binary...

03 March 2021 2,297 3 View

Sample dilution for quantitative analysis using ELISA?

If the detection range is in ng/ml but the reference range is in ug/ml for a molecule or protein in serum or plasma .how to dilute and what is the initial volume to be taken for quantitative analysis

02 March 2021 7,670 3 View

Does anyone have a recommendation for yeast reporter gene plasmid/protocol?

Hi, could anyone recommend a plasmid and/or protocol for reporter gene assay in S. cerevisiae? I want to assess the effect of growth conditions on a transcription factor, so I want to clone it`s...

01 March 2021 210 1 View

Good morning research fellows, Has anyone worked with senna alata plant extract on any kind of fish?

Literatures on the piscicidal effect of sennaa alata is scanty. if you have any related litrature either in the bark, leaves or roots used as treatment to any aquatic organism please kindly help...

28 February 2021 9,138 2 View

How to add missing citation?

Dear colleagues, I have found that many authors have a concern regarding their missing citation in RG because often citation in RG is lower than google scholars. I also missed some citation...

26 February 2021 928 6 View

Experimental Design: How deal with pseudreplicates with immunological and clinical-chemical paramaeters?

Hello everybody, I am investigating the influence of a toxinon various clinical-chemical and haematological parameters in fish. I have three treatments (control, low dose, high dose) in my...

24 February 2021 1,243 1 View

Hi i want to ask that in order to find out LC 50 (96 hours) of particular toxin for fish. Should we keep the animals with food or without food?

if we expose the fish after acclimatization to particular toxin in order to find out LC 50 (96 hours).Should we keep the fish off feed or with feed for that duration. Some literature show that...

24 February 2021 357 2 View

Standard curve shifting over time. How do I stabilise the ELISA?

24 February 2021 1,365 3 View

How we can measure Kemp % in wool without using of benzene?

Would you please let me to know about the methods for measurement of medullation and Kemp % on animal? My problem is that the wool sampling and sending to laboratory is not possible. So I would...

21 February 2021 7,260 4 View

Measuring Total immunoglobulin whole-body of fish larvae?

Hi Dear All, I prepared the extract of fish larvae whole body with PBS. Then protein concentration of the whole-body extraction samples determined by the Folin-Ceiocalteu-Phenol method (Lowry...

17 February 2021 1,971 3 View