Are there any genus level detection primers for fish species?

More Lakshmi Narayana Lavu's questions See All

Can you Suggest any institute that provides hands on training on NGS data analysis in India?

I am interested in attending a training session on NGS data analysis.

02 March 2019 5,785 2 View

Taqman probe PCR is failing to give fluorescence in qPCR. While the product is being amplified after cycling of same. Why?

Dear All,I hope everyone is doing good. I got 2 sets of primers and probes for a duplex PCR to screen for CamVP35 promoter region and Nos Terminator region detection. (I attached an excel...

11 December 2014 3,597 5 View

Is anyone familiar with BHQ1 modified probe solution?

Hi, Does anyone have an idea of the color of BHQ1 3' modified probe solution? One of my two probes was modified at 5' with FAM and at 3' with BHQ1 another one of them was modified at 5' with HEx...

11 December 2014 6,052 0 View

Can I replace the reporter dye without changing the probe sequence?

Hi, As a beginner of this I wanted to be clear about few things regarding fluorescent probes and their dyes. In one published document I selected below two probes for a duplex qPCR 1)....

10 November 2014 1,213 8 View

What is the most accurate way to quantify DNA?

Hi all, I have been using UV spectrometery for DNA quantification. Where is it limited to use within a certain OD range, though I get reliable repeatability with that. It doesn't support the...

10 November 2014 2,598 19 View

Multiple bands and laddering effect on agarose gel - any thoughts?

I am struggling with a serous problem in detection of GMO by routine PCR using CamvP35 and Nos amplification primers. This is a very serious problem I am facing since 4 months in our lab. Where I...

07 August 2014 1,404 10 View

Can anyone suggest the primers for detecting fish species (to cover the detection of most of the fish species)?

To investigate the adulteration of meat.

05 June 2014 4,927 5 View

What should be done if my pcr products are giving laddering effect even after altering the annealing temp. & using fresh aliquotes of every component?

1F- GCTCCTACAAATGCCATCA 1R- GATAGTGGGATTGTGCGTCA 2F- GCATGACGTTATTTATGAGATGGG 2R- GACACCGCGCGCGATAATTTATCC are the primers came with dst purification from sigma and taq dna polymerase from sigma...

04 May 2014 3,281 36 View

How does the hairpin formation of oligos effect the PCR in yielding specific product?

If my primer is able to form hairpin at an end, and causes non specific bands, how can I overcome this effect practically? Please suggest a way to avoid this without altering the primer base pair...

04 May 2014 5,455 6 View

What is the prepared reference material that can be used in inductively coupled plasma optical emission spectrometry (ICP-OES) to measure REE and U ?

What is the prepared reference material that can be used in the ICPE-9820 Shimadzu Japan instrument, which employs inductively coupled plasma optical emission spectrometry (ICP-OES) to measure...

06 August 2024 1,896 1 View

How to quantify polystyrene microplastic (8 micron) bioaccumulation in fish tissue?

"I have treated adult zebrafish with 8-micron polystyrene microplastic and want to study the bioaccumulation in different organs. Can this be done using hydrogen peroxide digestion followed by...

05 August 2024 853 3 View

Do anyone knows any book dealing with fish growth/zootechnical performances and somatic indexes in aquaculture?

In the aquaculture and fish nutrition research field, a number of growth and somatic indexes are often used, including specific growth rate (SGR), feed conversion rate (FCR), protein efficiency...

22 July 2024 2,480 4 View

Why do fish have fishy odors naturally ?

Chemical Engineering /Food Engineering

20 July 2024 4,152 4 View

Why Is My mtDNA Ct Value Higher Than Nuclear DNA in qPCR?

Hello everyone, I'm currently working on calculating the relative levels of mtDNA using qPCR by comparing the Ct values of a mitochondrial gene (nd1) and a nuclear gene. According to my...

16 July 2024 5,508 0 View

How can i generate a CRISPR knockin mutation zebrafish model with a reporter?

Hey! I aim to generate a transgenic knockin zebrafish line that mimetizes a genetic condtition that leads to a certain disease on human. To do so, I need to insert a codon for mutagenic aminoacid...

14 July 2024 6,240 0 View

Chromosomal spreads are shrunken after fluorescence in situ hybridization (FISH), why?

Dear colleagues, We are trying to do FISH on mice PDEC metaphase spreads. We use homemade biotin labelled probes, synthetized using a nick translation kit. For hybridization, initially we were...

08 July 2024 8,687 3 View

Is there any way to calculate whole genome similarity of organism without the whole genome sequencing ?

is there any ways that i can find genome similarity of an organism without whole genome sequencing ,like using maths formulas or experimental progress ?

05 July 2024 4,070 3 View

Determination of fatty acids in fish?

I measured the fatty acids in the fish, using the internal standard method in the national standard method, I first extracted the fish oil with cable extraction, please ask me how many grams of...

02 July 2024 900 1 View

How many fish otoliths and charophyte gyrogonites should you find in a sedimentary sample weighing 50g in order to be considered enviromental indices?

It's for my thesis on Quaternary costal sediments from Western Greece.

01 July 2024 4,854 0 View

Reddy Acs

plz go to canadian center for DNA barcoding( CCDB). they have published lot of primers for such study

Lakshmi Narayana Lavu

Thank you reddy sir.

Alessandro Benedetto

For detection of a large number of fish species in food and feed samples we developed few years ago a qPCR method.

"Towards a quantitative application of real-time PCR technique for fish DNA detection in feedstuffs." Food Chemistry 01/2011; 126:1436–1442

Hope it could be useful for your study.