Dear All,
I hope everyone is doing good.
I got 2 sets of primers and probes for a duplex PCR to screen for CamVP35 promoter region and Nos Terminator region detection. (I attached an excel sheet-list of primers and probes) and mentioned below
5’ FAM-CAAAGATGGACCCCCACCCACG- BHQ1 3’----P35 probe
5’ HEX-ATGGGTTTTTATGATTAGAGTCCCGCAA-BHQ1 3’ ----Nos probe
5’ GCCTCTGCCGACAGTGGT 3’------P35 Forward primer
5’ AAGACGTGGTTGGAACGTCTTC 3’------P35 Reverse primer
5’ CATGTAATGCATGACGTTATTTATG 3’------Nos Forward primer
5’ TTGTTTTCTATCGCGTATTAAATGT 3’------Nos Reverse primer
Both the probes were HPLC purified and primer sets were desalted.
I request you to look at the list.
When I received these oligos and probes. I made 100microM stocks with 1X TE solution. Primers are OK but two probe solutions are in dark ash color ( I thought BHQ1 might be the reason).
I did the standard curve experiment as per an ISO method (the sequences were published in ISO: 21569 recent edition) for this system with known gDNA standards. I fell sick seeing the data... there is no reaction crossed the baseline (actually while monitoring the run the fluorescence was in -0.04 level and did not touch the 0 at all).
I checked the PCR products (for P35 it is 84 and for Nos it is 82bp) on 4% agarose gel. all the reactions with known standards gave a clear specific amplification with a little primer dimer at bottom. NTC gave nothing. I did one more qPCR with them following kit recommendations (Promega A6102). Using 900nM primers and 250nM probes (gave no result)
Thought to put a simplex PCR separately for two detection systems. Even then I dint see positive fluorescence. I observed Nos detection system with HEX (-0.1) gave lesser fluorescence than FAM (-0.04).
I am sure about few things that
1). gDNA standard I've used is perfectly alright (giving positive amplification with routine PCR and its quantification data shows that it is good with purity and quantity)
2). Next is primer sets I ordered and used are working (+ve size with STD and no band in NTC on gel).
3). Water I used is nuclease free water provided along with promega kit.
4). My equipment is working fine (thermal cycling is OK proved my gel, but optical detection system was calibrated by factory for dyes Cy5, FAM, Green, Hex, ROX, VIC )
I did not understand the problem, whether the qPCR probe mastermix is not performing 5’ exonuclease activity for probes (it is giving amplicons of desired size after cycling-proved by gel). Or The probes that I ordered are not good (I reconstituted them as per one document of ABI-life tech, using 1X TE solution to dissolve and 1X TE to dilute for both probes and primers avoided exposure to light by wrapping tubes with reflecting foil).
As a newer to this technique, I am totally confused how to proceed and overcome if there is problem within the protocol.
Dear all I am requesting your help in solving my problem. Kindly do this favor.
Thank so much,
For me, your problem comes from your probes. Either they were not correctly designed (errors in some nucleotides or the probes are not between the primers), or they were not correctly manufacturated.
Verify for the first hypothesis (I think you already did). For the second, it depends on your manufacturer as it won't accept to send again probes without charges if you didn't use its mastermix. So if your probes are from Promega, call them and ask for new probes. If not (certainly from Life Technologies), test with the mastermix from the same manufacturer (at the same time, you will be able to test the unlikely hypothesis : problem with my mastermix).
Here, these probes and primers were synthesized by a local company (Bioserve biotechnology)..this company is giving all our primers with suitable quality since last 2years. So we gave the probes order to them. This is our first time performing this probe chemistry.
and mastermix is from promega,
the machine I am using is from Illumina.
As you noticed, the compatibility of mastermix with probes is a problem?
Please suggest
The sequences of primers and probes that I mentioned above were published by ISO in ISO 21569 -2013 amendment 1. I did not change their sequence but altered the 5' dye of 2nd probe from Yakima yellow to HEX. Because illumina system was not calibrated for YY but for HEX. this was the only change i've done.
Once after receiving the vials from synthesizer I double cross checked the mentioned sequences in its data sheet against the order we released and that ISO. everything was fine but no fluorescence after PCR.
You must find a system to test the fluorescence of the probe. And eventually, a problem of compatibility couls occur between mastermix and probe and machine.
Thanks Thomas for the valuable advice...
This compatibility check, I'm going to perform on another system. I'll definitely update that outcome once I finish it.
- Badges
- Science topic