Taqman probe PCR is failing to give fluorescence in qPCR. While the product is being amplified after cycling of same. Why?

Dear All,I hope everyone is doing good. I got 2 sets of primers and probes for a duplex PCR to screen for CamVP35 promoter region and Nos Terminator region detection. (I attached an excel...

11 December 2014 3,459 5 View

Is anyone familiar with BHQ1 modified probe solution?

11 December 2014 5,925 0 View

Are there any genus level detection primers for fish species?

10 November 2014 3,195 3 View

Can I replace the reporter dye without changing the probe sequence?

Hi, As a beginner of this I wanted to be clear about few things regarding fluorescent probes and their dyes. In one published document I selected below two probes for a duplex qPCR 1)....

10 November 2014 1,091 8 View

What is the most accurate way to quantify DNA?

Hi all, I have been using UV spectrometery for DNA quantification. Where is it limited to use within a certain OD range, though I get reliable repeatability with that. It doesn't support the...

10 November 2014 2,454 19 View

Multiple bands and laddering effect on agarose gel - any thoughts?

07 August 2014 1,269 10 View

Can anyone suggest the primers for detecting fish species (to cover the detection of most of the fish species)?

To investigate the adulteration of meat.

05 June 2014 4,756 5 View

What should be done if my pcr products are giving laddering effect even after altering the annealing temp. & using fresh aliquotes of every component?

1F- GCTCCTACAAATGCCATCA 1R- GATAGTGGGATTGTGCGTCA 2F- GCATGACGTTATTTATGAGATGGG 2R- GACACCGCGCGCGATAATTTATCC are the primers came with dst purification from sigma and taq dna polymerase from sigma...

04 May 2014 3,154 36 View

How does the hairpin formation of oligos effect the PCR in yielding specific product?

If my primer is able to form hairpin at an end, and causes non specific bands, how can I overcome this effect practically? Please suggest a way to avoid this without altering the primer base pair...

04 May 2014 5,290 6 View

How to compare two groups with only two measurements?

Hiiiii everyone! I have an enquiry on statistical analysis. I was looking for many forum and it's still cannot solve my problem. I want to compare means of two groups of data but only with two...

03 March 2021 8,796 3 View

Enhanced Yellow Fluorescent Protein (Aequorea victoria) DNA sequence?

I am on the lookout for the Enhanced Yellow Fluorescent Protein (Aequorea victoria) DNA sequence. Does anyone know where I can find it? Thank you in advance

03 March 2021 3,568 1 View

What kind of fluid could I use for a pitfall trap that also does not invalidate molecular testing?

Hi, I want to start testing pitfall trap to obtain ants samples, but I need to conduct molecular analysis on those insects. So, what kind of fluid can I use? Ethanol expires too early and I need...

03 March 2021 5,978 5 View

What's the best way to measure growth rates in House sparrow chicks from day 2 to day 10?

What's the best way to measure growth rates in House sparrow chicks from day 2 to day 10? Since, the growth curve from day 2 to 10 won't be like the "Logistic curve" it might not follow logistic...

03 March 2021 1,401 3 View

Do we need to write protocol for a second study of a systematic review that has been registered and published?

I have conducted and published a systematic review and meta-analysis research with the topic related to public health and health pomotion (protocol was registed in PROSPERO). Now we want to...

03 March 2021 8,920 3 View

How to increase a model accuracy ?

dear community, my model is based feature extraction from non stationary signals using discrete Wavelet Transform and then using statistical features then machine learning classifiers in order to...

03 March 2021 6,994 5 View

1. What is the impact of having different scales in a survey? and how can we solve this problem before and after data collection (Literature)?

1. What is the impact of having different scales in a survey? and how can we solve this problem before and after data collection (Literature-based reflection)? Thank you for your time and for...

03 March 2021 2,870 3 View

What degree of missing data in a particular case/participant results in Expectation-Maximisation no longer working?

I'm dealing with a mediation model and am using the PROCESS module in SPSS. Due to SPSS and PROCESS being limited in the imputation methods - being unable to handle multiple imputation - the other...

02 March 2021 4,362 1 View

Do I need to do linear regression before running mediation analysis using PROCESS MACRO by Hayes ?

I just wanted to check if I need to run a linear regression separately if I am using PROCESS MACRO to run mediation analysis. Thank you.

02 March 2021 4,359 3 View

Sample dilution for quantitative analysis using ELISA?

If the detection range is in ng/ml but the reference range is in ug/ml for a molecule or protein in serum or plasma .how to dilute and what is the initial volume to be taken for quantitative analysis

02 March 2021 7,670 3 View