Can you Suggest any institute that provides hands on training on NGS data analysis in India?

I am interested in attending a training session on NGS data analysis.

02 March 2019 5,657 2 View

Taqman probe PCR is failing to give fluorescence in qPCR. While the product is being amplified after cycling of same. Why?

Dear All,I hope everyone is doing good. I got 2 sets of primers and probes for a duplex PCR to screen for CamVP35 promoter region and Nos Terminator region detection. (I attached an excel...

11 December 2014 3,459 5 View

Is anyone familiar with BHQ1 modified probe solution?

11 December 2014 5,925 0 View

Are there any genus level detection primers for fish species?

10 November 2014 3,195 3 View

Can I replace the reporter dye without changing the probe sequence?

Hi, As a beginner of this I wanted to be clear about few things regarding fluorescent probes and their dyes. In one published document I selected below two probes for a duplex qPCR 1)....

10 November 2014 1,091 8 View

What is the most accurate way to quantify DNA?

Hi all, I have been using UV spectrometery for DNA quantification. Where is it limited to use within a certain OD range, though I get reliable repeatability with that. It doesn't support the...

10 November 2014 2,454 19 View

Multiple bands and laddering effect on agarose gel - any thoughts?

07 August 2014 1,269 10 View

What should be done if my pcr products are giving laddering effect even after altering the annealing temp. & using fresh aliquotes of every component?

1F- GCTCCTACAAATGCCATCA 1R- GATAGTGGGATTGTGCGTCA 2F- GCATGACGTTATTTATGAGATGGG 2R- GACACCGCGCGCGATAATTTATCC are the primers came with dst purification from sigma and taq dna polymerase from sigma...

04 May 2014 3,154 36 View

How does the hairpin formation of oligos effect the PCR in yielding specific product?

If my primer is able to form hairpin at an end, and causes non specific bands, how can I overcome this effect practically? Please suggest a way to avoid this without altering the primer base pair...

04 May 2014 5,290 6 View

MD MOE RMSD

How to calculate the RMSD values for a MD simulation using MOE?

07 August 2021 0 0 View

MD MOE RMSD

How to calculate the RMSD values for a MD simulation using MOE?

07 August 2021 0 0 View

fatal error

When I tried to energy minimization my system, I got fatal error as below. Fatal error: Atomtype opls_116 not found Although I've already added this line: ; include water #include "oplsaa.ff/spc.itp" to [molecultype] directive in my topology.

16 June 2021 0 0 View

fatal error

When I tried to energy minimization my system, I got fatal error as below. Fatal error: Atomtype opls_116 not found Although I've already added this line: ; include water #include "oplsaa.ff/spc.itp" to [molecultype] directive in my topology.

16 June 2021 0 0 View

fatal error

When I tried to energy minimization my system, I got fatal error as below. Fatal error: Atomtype opls_116 not found Although I've already added this line: ; include water #include "oplsaa.ff/spc.itp" to [molecultype] directive in my topology.

16 June 2021 0 0 View

fatal error

When I tried to energy minimization my system, I got fatal error as below. Fatal error: Atomtype opls_116 not found Although I've already added this line: ; include water #include "oplsaa.ff/spc.itp" to [molecultype] directive in my topology.

16 June 2021 0 0 View

Binary Logistic Generalized Linear Mixed model in SPSS. Is it doable?

I want to analyses the proportion of swimming sperm of three species of fish in two salinities. To analyse the proportion of swimming sperm in a Generalized Linear Model, I would use a Binary...

03 March 2021 2,297 3 View

What kind of fluid could I use for a pitfall trap that also does not invalidate molecular testing?

Hi, I want to start testing pitfall trap to obtain ants samples, but I need to conduct molecular analysis on those insects. So, what kind of fluid can I use? Ethanol expires too early and I need...

03 March 2021 5,978 5 View

No title

02 March 2021 3,060 3 View

How to repeat an operation on an atom selection for multiple times in PyMol?

Hi, I am trying to construct a multi-layer fibril structure from a single layer in PyMol by translating the layer along the fibril axis. For now, I am able to use the Translate command in PyMol...

02 March 2021 4,569 4 View