Is anyone familiar with BHQ1 modified probe solution?

Lakshmi Narayana Lavu @Lakshmi_Narayana_Lavu

12 December 2014 0 6K Report

Hi,

Does anyone have an idea of the color of BHQ1 3' modified probe solution?

One of my two probes was modified at 5' with FAM and at 3' with BHQ1

another one of them was modified at 5' with HEx and at 3' with BHQ1.

When I reconstituted them, they both turned into a dark ash color.

I had no idea which color they should be.

So please clarify my doubt..

Badges
Science topic

More Lakshmi Narayana Lavu's questions See All

Can you Suggest any institute that provides hands on training on NGS data analysis in India?

I am interested in attending a training session on NGS data analysis.

02 March 2019 5,657 2 View

Taqman probe PCR is failing to give fluorescence in qPCR. While the product is being amplified after cycling of same. Why?

Dear All,I hope everyone is doing good. I got 2 sets of primers and probes for a duplex PCR to screen for CamVP35 promoter region and Nos Terminator region detection. (I attached an excel...

11 December 2014 3,459 5 View

Are there any genus level detection primers for fish species?

10 November 2014 3,195 3 View

Can I replace the reporter dye without changing the probe sequence?

Hi, As a beginner of this I wanted to be clear about few things regarding fluorescent probes and their dyes. In one published document I selected below two probes for a duplex qPCR 1)....

10 November 2014 1,091 8 View

What is the most accurate way to quantify DNA?

Hi all, I have been using UV spectrometery for DNA quantification. Where is it limited to use within a certain OD range, though I get reliable repeatability with that. It doesn't support the...

10 November 2014 2,454 19 View

Multiple bands and laddering effect on agarose gel - any thoughts?

07 August 2014 1,269 10 View

Can anyone suggest the primers for detecting fish species (to cover the detection of most of the fish species)?

To investigate the adulteration of meat.

05 June 2014 4,756 5 View

What should be done if my pcr products are giving laddering effect even after altering the annealing temp. & using fresh aliquotes of every component?

1F- GCTCCTACAAATGCCATCA 1R- GATAGTGGGATTGTGCGTCA 2F- GCATGACGTTATTTATGAGATGGG 2R- GACACCGCGCGCGATAATTTATCC are the primers came with dst purification from sigma and taq dna polymerase from sigma...

04 May 2014 3,154 36 View

How does the hairpin formation of oligos effect the PCR in yielding specific product?

If my primer is able to form hairpin at an end, and causes non specific bands, how can I overcome this effect practically? Please suggest a way to avoid this without altering the primer base pair...

04 May 2014 5,290 6 View

MD MOE RMSD

How to calculate the RMSD values for a MD simulation using MOE?

07 August 2021 0 0 View

MD MOE RMSD

How to calculate the RMSD values for a MD simulation using MOE?

07 August 2021 0 0 View

fatal error

When I tried to energy minimization my system, I got fatal error as below. Fatal error: Atomtype opls_116 not found Although I've already added this line: ; include water #include "oplsaa.ff/spc.itp" to [molecultype] directive in my topology.

16 June 2021 0 0 View

fatal error

16 June 2021 0 0 View

fatal error

16 June 2021 0 0 View

fatal error

16 June 2021 0 0 View

flexibility of polymers chain

effect of double bond on the flexibility of polymers

07 April 2021 0 0 View

Formulation of polymer color flakes

I am writing to request some information for making polymer color flakes. I would appreciate the help.

17 March 2021 0 0 View

What is your perception on using visual analysis or quantitative approaches to evaluate data from single-case research designs (n of 1 trials)?

Results of single-case research designs (i.e., n-of-1 trials) are often evaluated by visually inspecting the time-series graph and computing quantitative indices. A question our research team is...

03 March 2021 687 1 View

How do I increase the yield of my PCR product?

Hello, We would like to increase the yield of our PCR product. We are running a series of PCR reactions that is targeting ~1.1kb sequence. We begin each reaction with ~400pg of template DNA...

02 March 2021 4,029 3 View