Lakshmi Narayana Lavu

10 Questions 64 Answers 0 Followers

Questions related from Lakshmi Narayana Lavu

Can you Suggest any institute that provides hands on training on NGS data analysis in India?

I am interested in attending a training session on NGS data analysis.

03 March 2019 5,725 2 View

Is anyone familiar with BHQ1 modified probe solution?

Hi, Does anyone have an idea of the color of BHQ1 3' modified probe solution? One of my two probes was modified at 5' with FAM and at 3' with BHQ1 another one of them was modified at 5' with HEx...

12 December 2014 6,000 0 View

Taqman probe PCR is failing to give fluorescence in qPCR. While the product is being amplified after cycling of same. Why?

Dear All,I hope everyone is doing good. I got 2 sets of primers and probes for a duplex PCR to screen for CamVP35 promoter region and Nos Terminator region detection. (I attached an excel...

12 December 2014 3,535 5 View

Can I replace the reporter dye without changing the probe sequence?

Hi, As a beginner of this I wanted to be clear about few things regarding fluorescent probes and their dyes. In one published document I selected below two probes for a duplex qPCR 1)....

11 November 2014 1,163 8 View

What is the most accurate way to quantify DNA?

Hi all, I have been using UV spectrometery for DNA quantification. Where is it limited to use within a certain OD range, though I get reliable repeatability with that. It doesn't support the...

11 November 2014 2,526 19 View

Are there any genus level detection primers for fish species?

Are there good working references to gene or it's primers set for detecting fish species (to cover most possible number of abundant fish species) in food samples using routine PCR?

11 November 2014 3,282 3 View

Multiple bands and laddering effect on agarose gel - any thoughts?

I am struggling with a serous problem in detection of GMO by routine PCR using CamvP35 and Nos amplification primers. This is a very serious problem I am facing since 4 months in our lab. Where I...

08 August 2014 1,342 10 View

Can anyone suggest the primers for detecting fish species (to cover the detection of most of the fish species)?

To investigate the adulteration of meat.

06 June 2014 4,846 5 View

How does the hairpin formation of oligos effect the PCR in yielding specific product?

If my primer is able to form hairpin at an end, and causes non specific bands, how can I overcome this effect practically? Please suggest a way to avoid this without altering the primer base pair...

05 May 2014 5,381 6 View

What should be done if my pcr products are giving laddering effect even after altering the annealing temp. & using fresh aliquotes of every component?

1F- GCTCCTACAAATGCCATCA 1R- GATAGTGGGATTGTGCGTCA 2F- GCATGACGTTATTTATGAGATGGG 2R- GACACCGCGCGCGATAATTTATCC are the primers came with dst purification from sigma and taq dna polymerase from sigma...

05 May 2014 3,209 36 View