10 Questions 64 Answers 0 Followers
Questions related from Lakshmi Narayana Lavu
I am interested in attending a training session on NGS data analysis.
03 March 2019 5,725 2 View
Hi, Does anyone have an idea of the color of BHQ1 3' modified probe solution? One of my two probes was modified at 5' with FAM and at 3' with BHQ1 another one of them was modified at 5' with HEx...
12 December 2014 6,000 0 View
Dear All,I hope everyone is doing good. I got 2 sets of primers and probes for a duplex PCR to screen for CamVP35 promoter region and Nos Terminator region detection. (I attached an excel...
12 December 2014 3,535 5 View
Hi, As a beginner of this I wanted to be clear about few things regarding fluorescent probes and their dyes. In one published document I selected below two probes for a duplex qPCR 1)....
11 November 2014 1,163 8 View
Hi all, I have been using UV spectrometery for DNA quantification. Where is it limited to use within a certain OD range, though I get reliable repeatability with that. It doesn't support the...
11 November 2014 2,526 19 View
Are there good working references to gene or it's primers set for detecting fish species (to cover most possible number of abundant fish species) in food samples using routine PCR?
11 November 2014 3,282 3 View
I am struggling with a serous problem in detection of GMO by routine PCR using CamvP35 and Nos amplification primers. This is a very serious problem I am facing since 4 months in our lab. Where I...
08 August 2014 1,342 10 View
To investigate the adulteration of meat.
06 June 2014 4,846 5 View
If my primer is able to form hairpin at an end, and causes non specific bands, how can I overcome this effect practically? Please suggest a way to avoid this without altering the primer base pair...
05 May 2014 5,381 6 View
1F- GCTCCTACAAATGCCATCA 1R- GATAGTGGGATTGTGCGTCA 2F- GCATGACGTTATTTATGAGATGGG 2R- GACACCGCGCGCGATAATTTATCC are the primers came with dst purification from sigma and taq dna polymerase from sigma...
05 May 2014 3,209 36 View