Hi,
I'm trying to do a base editing. My target gene is MYBBP3A, the guide RNA I'm using is ACTCGCGACTGTGCTTCAAT and I cloned it in the pLentiguide-puro (Addgene 52963). I used this guide because there are a C base in 4th and 6th positions. I nucleofected 1 million of Hek293 with 500 ng of this plasmid and 1500 ng of the pCMV-BE3 plasmid (Addgene 73021). For the nucleofection I used the Nucleofector 4D (SF cell line kit). As control I transfected 1 million of HEK293 with 1 microgram of pMAX-GFP. 72 hours after the nucleofection, I lyzed cells, did a PCR of the target region and sequenced it. In the control there was 92% of GFP positive cells. But nor TIDE or ICE software show a T base in 4th or 6th position when I check my sequence.
Where is th trouble ? Can you help me please ? Have you some advices to give me ?
Thank you.
Dear Romain,
I have no experience in conducting experiments with base editors, but based on my experience in genome editing experiments, I suspect the plasmid vector introduction efficiency and cleavage activity as the cause of failure.
The two plasmid vectors are 10 kb and 8 kb, respectively, while pMAX-GFP is 3.5 kb. pMAX-GFP has a transduction efficiency of 92%. The two vectors may have significantly lower transduction efficiency due to their larger size.
It is also unclear whether the gRNA sequences used are appropriate. As a control experiment, it would be better to use a vector expressing wild-type SpCas9-GFP instead of BE3 and evaluate whether CRISPR/Cas9 shows high cleavage activity.
It may be difficult to detect mutations in TIDE and ICE if the same mutation is less than a few percent.
Best,
I agree with the above.
Lonza's GFP plasmid always works much better than anything else.
as you have puro in your guide plasmid you could do a quick selection (starting 0-24h after EP) and thus at least enrich for cells that have the guide.
Alternatively first do lenti transductions with the guide vector only and then EP with your base editor.
If your BE creates/destroys restriction sites it may also be a sensitive way to check. Or T7/surveyor.
Hope that helps!
Narumi Uno Thanks for your answer. My gRNA is very efficient. I used it in the past to do a knock-out. 24 hours after transfection, its efficiency was 30%.
Romain Gioia Thank you for more information. That's a very efficient. I'm sorry, but I don't think I can help you any further.
Best,
Bonjour Romain,
Un petit message de Bordeaux! J'ai utilisé pas mal de BE et j'ai pu constater que même si le gRNA est efficace pour une coupure, il peut n'y avoir aucune efficacité du BE dans sa fenêtre d'action. Mais quand ça marche, on le voit à l'oeil sur le chromatogramme Sanger et quelquefois jusqu'à 50% d'édition. Le plasmide que tu utilises pour le gRNA est très gros et du coup avec une moins bonne efficacité de transfection. J'utilise un tout petit plasmide dérivé du pUC19 pour cloner les gRNA et éviter ces problèmes d'efficacité de transfection. J'avais essayé d'introduire la cassette d'expression du gRNA dans mes plasmides BE mais pour l'instant ça n'a pas marché!
All the best
Bonjour Valerie Prouzet-Mauleon
Un plaisir pour moi de découvrir ce petit message. Je te rend le bonjour et tu le transmettra à Béa et aux anciens de l'U1035 si tu les côtoient encore. Merci pour ta réponse, je vais en tenir compte pour ma prochaine tentative.
Je transmets avec plaisir Romain!
Good luck for your experiments
- Badges
- Science method