Any idea of the species?
Catch in may, near roscoff in brittany,
No oil globule, size 1.2mm
The specimen is well marked with melanophore, and pectoral fins are already pigmented (as seen on photo)
thanks
I'm looking for a durable and user-friendly system to filter SPOM while on a boat in the field. The last one I used was the Mityvac Hand Vacuum Pump, but the plastic handle broke after intensive...
17 March 2024 3,877 0 View
I did a western blot with 25ug of protein lysate. As control, i used the recombinant protein and cell who not express my protein. The first antibody (rabbit polyclonal) recognize only the...
14 June 2023 7,853 3 View
Dans le cadre d'un projet d'étude dosimétrique, je me dois d’effectuer une simulation de radium 226 à l'équilibre. Afin d'utiliser au mieux le logiciel GATE, et d’interpréter correctement les...
29 May 2023 8,462 0 View
Hi, I have a question about FACS and copy number estimation of a protein of interest. We have a protein of interest (on the membrane surface) that we are studying and we have an antibody coupled...
21 February 2023 1,931 0 View
Hello everyone, I am looking to study the fluorescence intensity of GFP in a GRAM positive bacterium. The culture medium is M17+sucrose+glucose. Does this medium fluoresce in the GFP wavelengths?...
14 February 2022 7,195 2 View
Hi, I'm trying to develop a KO cell line from an established cancer cell line. My gene of interest is present in 3 copies in this cell line. I'm using a multi-sgRNAs technique to increase my...
01 December 2021 8,770 5 View
Hi there, Working on C fluxes and stocks quantification, I would like to know if SMAP L4 Carbon products are reliable enough for other ecosystems than boreal forests (GPP, NEE, RH, SOC). Indeed,...
20 July 2021 7,251 0 View
Hi, I'm trying to do a base editing. My target gene is MYBBP3A, the guide RNA I'm using is ACTCGCGACTGTGCTTCAAT and I cloned it in the pLentiguide-puro (Addgene 52963). I used this guide because...
27 June 2021 2,139 7 View
Hello everyone, I'm really not familiar with molecular biology protocols, and I try to obtain several constructs of my protein by doing PCRs and ligation starting from a WT-plasmid. I...
13 May 2021 2,871 7 View
Dear community, On average cerebellar granule cells have four dendrites (if I am correct). I wonder here if in realistic condition inputs coming from a single denrite can trigger a spike in a...
21 March 2021 2,285 1 View
"I have treated adult zebrafish with 8-micron polystyrene microplastic and want to study the bioaccumulation in different organs. Can this be done using hydrogen peroxide digestion followed by...
05 August 2024 853 3 View
In the aquaculture and fish nutrition research field, a number of growth and somatic indexes are often used, including specific growth rate (SGR), feed conversion rate (FCR), protein efficiency...
22 July 2024 2,480 4 View
Chemical Engineering /Food Engineering
20 July 2024 4,152 4 View
Dear colleagues, We are trying to do FISH on mice PDEC metaphase spreads. We use homemade biotin labelled probes, synthetized using a nick translation kit. For hybridization, initially we were...
08 July 2024 8,687 3 View
I have mouse lung tissue which is mounted with egg whites.I need to stain my tissues with PAS and HE. Can egg whites interfere with these stainings?
02 July 2024 8,261 0 View
I measured the fatty acids in the fish, using the internal standard method in the national standard method, I first extracted the fish oil with cable extraction, please ask me how many grams of...
02 July 2024 900 1 View
It's for my thesis on Quaternary costal sediments from Western Greece.
01 July 2024 4,854 0 View
Other than Sparids
27 June 2024 1,809 0 View
No response from fish physiology and biochemistry journal after a year of peer review. Journal editorial team is not responding even for Request for withdrawal of our manuscript. We are struck...
25 June 2024 8,918 0 View
We have been rearing Rockefeller mosquitoes for many years in our laboratory without any problems, but lately, in spite of good viability of eggs and unchanged environmental conditions (27°C,...
20 June 2024 3,515 2 View