3 Questions 4 Answers 0 Followers
Questions related from Romain Gioia
I did a western blot with 25ug of protein lysate. As control, i used the recombinant protein and cell who not express my protein. The first antibody (rabbit polyclonal) recognize only the...
15 June 2023 7,847 3 View
Hi, I'm trying to do a base editing. My target gene is MYBBP3A, the guide RNA I'm using is ACTCGCGACTGTGCTTCAAT and I cloned it in the pLentiguide-puro (Addgene 52963). I used this guide because...
28 June 2021 2,132 7 View
Hello everyone! To insert a point mutation by using a CRISPR-Cas9 approach, I tried different crRNA close to the mutation (with Cpf1 or Cas9) but all are inefficient. I don't have the choice to...
17 March 2021 3,971 3 View