Romain Gioia

5 Questions 4 Answers 0 Followers

Questions related from Romain Gioia

Is a 3'-5' oriented gRNA effective?

Hi, I want to edit a SNP in a non-coding sequence. I can't use the CRISPR HDR approach or prime editing because the PAM or the binding site of gRNA in the ssODN or pegRNA would be changed. I need...

03 April 2025 6,686 0 View

How to reduce the effectiveness of a guide RNA?

Hi everyone, I'm trying to obtain a heterozygous clone (wt/KO) using a CRISPR-Cas9GFP RNP approach on iPSC-Like. After the nucleofection, 90% of cells are GFP+. After sorting cells, only 4% have a...

03 July 2024 4,885 1 View

Why an antibody can recognize a recombinant protein but not the endogenous protein in a western blot ?

I did a western blot with 25ug of protein lysate. As control, i used the recombinant protein and cell who not express my protein. The first antibody (rabbit polyclonal) recognize only the...

15 June 2023 7,880 3 View

What is the trouble with my base editing ?

Hi, I'm trying to do a base editing. My target gene is MYBBP3A, the guide RNA I'm using is ACTCGCGACTGTGCTTCAAT and I cloned it in the pLentiguide-puro (Addgene 52963). I used this guide because...

28 June 2021 2,168 7 View

Where should I design the gRNA if I want to insert point mutations with CRISPR/Cas9?

Hello everyone! To insert a point mutation by using a CRISPR-Cas9 approach, I tried different crRNA close to the mutation (with Cpf1 or Cas9) but all are inefficient. I don't have the choice to...

17 March 2021 4,006 3 View