Quelle est la meilleur façon de simuler du radium 226 à l'équilibre sur GATE?

Romain Scharrenberger @Romain-Scharrenberger

30 May 2023 0 8K Report

Dans le cadre d'un projet d'étude dosimétrique, je me dois d’effectuer une simulation de radium 226 à l'équilibre. Afin d'utiliser au mieux le logiciel GATE, et d’interpréter correctement les résultats donner pas le logiciel ( dose en Gy ) j'aimerais savoir si quelqu'un à déjà du faire ce type de simulation.

Badges
Science topic

More Romain Scharrenberger's questions See All

Fish eggs ID?

Any idea of the species? Catch in may, near roscoff in brittany, No oil globule, size 1.2mm The specimen is well marked with melanophore, and pectoral fins are already pigmented (as seen on...

26 May 2024 7,624 0 View

Which brand of hand vacuum pump do you recommend for suspending particulate organic matter (SPOM) filtration?

I'm looking for a durable and user-friendly system to filter SPOM while on a boat in the field. The last one I used was the Mityvac Hand Vacuum Pump, but the plastic handle broke after intensive...

17 March 2024 3,877 0 View

Why an antibody can recognize a recombinant protein but not the endogenous protein in a western blot ?

I did a western blot with 25ug of protein lysate. As control, i used the recombinant protein and cell who not express my protein. The first antibody (rabbit polyclonal) recognize only the...

14 June 2023 7,853 3 View

Why our copy number analysis fluctuates with Quantibrite PE beads?

Hi, I have a question about FACS and copy number estimation of a protein of interest. We have a protein of interest (on the membrane surface) that we are studying and we have an antibody coupled...

21 February 2023 1,931 0 View

Culture medium SGM17 fluoresce (GFP)?

Hello everyone, I am looking to study the fluorescence intensity of GFP in a GRAM positive bacterium. The culture medium is M17+sucrose+glucose. Does this medium fluoresce in the GFP wavelengths?...

14 February 2022 7,194 2 View

What do I still have multiple bands after isolating each bands through Gel extraction ?

Hi, I'm trying to develop a KO cell line from an established cancer cell line. My gene of interest is present in 3 copies in this cell line. I'm using a multi-sgRNAs technique to increase my...

01 December 2021 8,770 5 View

SMAP L4 Carbon product: suitable for all ecosystems?

Hi there, Working on C fluxes and stocks quantification, I would like to know if SMAP L4 Carbon products are reliable enough for other ecosystems than boreal forests (GPP, NEE, RH, SOC). Indeed,...

20 July 2021 7,251 0 View

What is the trouble with my base editing ?

Hi, I'm trying to do a base editing. My target gene is MYBBP3A, the guide RNA I'm using is ACTCGCGACTGTGCTTCAAT and I cloned it in the pLentiguide-puro (Addgene 52963). I used this guide because...

27 June 2021 2,139 7 View

Why my transformation does not work after successful ligation ?

Hello everyone, I'm really not familiar with molecular biology protocols, and I try to obtain several constructs of my protein by doing PCRs and ligation starting from a WT-plasmid. I...

13 May 2021 2,871 7 View

Can input coming from a single dendrite trigger the spiking of cerebellar granule cell?

Dear community, On average cerebellar granule cells have four dendrites (if I am correct). I wonder here if in realistic condition inputs coming from a single denrite can trigger a spike in a...

21 March 2021 2,285 1 View

How do I conformally do PR spin coating on trench structure?

I did PR spin coating on trench structure. I used AZ P4620 PR and the thickness or PR is around 11um. The substrate is Si. And my trench structure depth is 141um(negative way). Even though I...

08 August 2024 2,298 0 View

How can I find access to heavy metal reference doses from the EPA and WHO websites?

Reference dose and Maximum acceptable concentrations HMs

03 August 2024 8,230 4 View

How to convert g/kg Humic acid dose to kg/ha?

I used humic acid at 0.044 g/kg soil in my pot experiment. But finally, I have to recommend kg/ha. Each pot's soil weight was 11 kg. What is the solution?

02 August 2024 7,186 6 View

Issues with Protein Expression in Transfected cells?

Hello I am trying to create a stable cell line in HEK293 via Lipofectamine 3000 transfection. My plasmid is a CD63-IL10-GFP construct with Puromycin resistance. I am successful with the...

30 July 2024 6,648 1 View

How to make chocolate milk ?

we want to produce chocolate milk industrally .Dose anyone have a specific stabilizer formula for this pourpose?

10 July 2024 3,791 1 View

What statistical test to do for dose response graphs?

Hello, I am currently conducting research on ovarian tumour cells and the use of chemotherapies with dietary metabolites and their combinations to see if there is a difference in cell viability. I...

01 July 2024 6,100 2 View

What are the best techniques(3D-CRT, and VMAT) of radiotherapy is recommended for treating recurrent breast cancer ?

i want to calculate the dose distribution by using different algorithm.

29 June 2024 5,333 3 View

When IC50 cannot be obtained according to the cell viability chart, what should be the dose selection under cell culture conditions?

When IC50 cannot be obtained according to the cell viability chart, what should be the dose selection under cell culture conditions? Would it be beneficial to go with sham control? For example,...

11 June 2024 9,109 0 View

Can you discuss the monitoring strategies for patients onantiplatelet therapy and when dose adjustments may benecessary?

Antiplatelet Therapy: Mechanisms, Indications, Administration Can you discuss the monitoring strategies for patients onantiplatelet therapy and when dose adjustments may benecessary?

05 June 2024 8,874 1 View

What is the role of pharmacists in the management ofantiplatelet therapy, particularly in terms of drug selection,dosing, and monitoring for drug int?

Antiplatelet Therapy: Mechanisms, Indications, Administration What is the role of pharmacists in the management ofantiplatelet therapy, particularly in terms of drug selection,dosing, and...

05 June 2024 2,060 2 View