I'm doing RT-PCRs. Which gene is considered a good internal control for tobacco?
Hi,
We used EF-1 elongation factor for different plants, including N. tabacum. Worked for us :) But there are others, please read this:
http://link.springer.com/article/10.1007%2Fs00438-010-0511-1
thanks Alexander, I'm using ubiquitin..but not too sure if it's the best one
I have been using Ubiquitin. it works very well in our lab.
NtUBI (ubiquitin)
Forward primer TCCAGGACAAGGAGGGTAT
Primers primer GAGACCTCAGTAGACAAAGC
Thanks for the sequence Dr. Trivedi
I also use EF-1 alpha elongation factor as internal control. It works well in N. tabacum.
Post Covid 19 the scenario in India has changed and some of the private insurance companies are providing coverages for mental disorders. So My question is what mental disorders are covered in...
04 January 2021 6,474 10 View
I use Fugene-3ul/well, pclEco- 0.8ng and polybrene 2ul/ml from 5mg/ml stock. I usually spinfect T cells that I have activated a day before with anti-CD28 and anti-CD3. I use MigR2 plasmid with my...
08 December 2019 3,649 3 View
My protein of interest has a carbohydrate binding module-like domain, can I check if it binds to cellulose/pectin/xylans?
22 October 2013 10,008 2 View
My transgenic is positive for DNA (in PCR) and transcript (in RT-PCR) of my transgene, but when I did an ELISA there was no protein expression observed. There must be some sort of silencing...
09 September 2013 3,729 13 View
Results of single-case research designs (i.e., n-of-1 trials) are often evaluated by visually inspecting the time-series graph and computing quantitative indices. A question our research team is...
03 March 2021 687 1 View
Hello, We would like to increase the yield of our PCR product. We are running a series of PCR reactions that is targeting ~1.1kb sequence. We begin each reaction with ~400pg of template DNA...
02 March 2021 4,029 3 View
Estemeed colleagues, I found some issues regarding the quantification of the data for TNBS assay. There are different protocols on how to perform that but it is clear to me the "fil rouge" that...
02 March 2021 2,616 1 View
If the detection range is in ng/ml but the reference range is in ug/ml for a molecule or protein in serum or plasma .how to dilute and what is the initial volume to be taken for quantitative analysis
02 March 2021 7,670 3 View
I am searching for a good place for the Post Doc,
02 March 2021 4,053 3 View
For my research i will need to measure plant quantitative traits (especially leaves area and roots length, but would be nice to add some more information). I recently discovered...
01 March 2021 5,035 2 View
I am going to have 3 different probes in my qPCR work that I am going to do. But I realized that the machine we have in the lab is a Rotor-Gene Q 2plex HRM Platform, saying it has green, yellow,...
01 March 2021 8,544 1 View
I want to find a quorum sensing inhibitor from plant extracts. Klebsiella pneumoniae, Moraxella catarrhalis, Staphylococcus aureus, and Streptococcus pneumoniae. I looked for these strains...
01 March 2021 7,675 3 View
To dear Researchers, I was analyzing a series of concentration for estimation of Real-Time PCR efficiency. The concentration was 1:10. I used MS-excel to evaluate Slope. The result of slope was -8...
01 March 2021 8,683 4 View
Does anyone have the experience of using Taq Man probes in the QIAGEN Rotar- Gene qPCR machine?
01 March 2021 5,311 1 View