I'm doing RT-PCRs. Which gene is considered a good internal control for tobacco?
Hi,
We used EF-1 elongation factor for different plants, including N. tabacum. Worked for us :) But there are others, please read this:
http://link.springer.com/article/10.1007%2Fs00438-010-0511-1
thanks Alexander, I'm using ubiquitin..but not too sure if it's the best one
I have been using Ubiquitin. it works very well in our lab.
NtUBI (ubiquitin)
Forward primer TCCAGGACAAGGAGGGTAT
Primers primer GAGACCTCAGTAGACAAAGC
Thanks for the sequence Dr. Trivedi
I also use EF-1 alpha elongation factor as internal control. It works well in N. tabacum.
I don't have 1.5M tris HCl buffer for the resolving gel but I have 1 M tris HCl buffer with pH 8.8 will that work for SDS PAGE? do I need to change the amount added to the mix?
11 June 2024 5,753 3 View
I am working with mouse bone marrow. Need CD45, six isoform primer sequences (mouse).These isoforms are generated through alternative splicing of exon 4,5 and 6. NCBI Reference Sequence:...
13 February 2024 7,041 0 View
i am working with lyophilised porcine skin. what tests can be carried out on the extracted sample to determine what proteins/ components are present?
08 February 2024 9,129 0 View
please share an easy-to-follow protocol of lowry assay, along with the method to prepare BSA standard graph in the range of 5ug/ ml to 100ug/ml
16 August 2023 8,572 0 View
hi, I am working on extracting proteins from pig skin. Initially, I used plain 0.5 M acetic acid solution for extracting proteins and used the solution as such post-centrifugation. but the protein...
31 July 2023 5,737 3 View
I am working with protein extraction using porcine skin. prior to protein extraction I need to de-fat the tissue. I am using triton x to de-fat the tissue... how to determine if the defatting is...
19 July 2023 9,930 4 View
Please, share any links or papers that can help me know more about the ways to calibrate the instrument and how regularly the calibration must be done. Thank You for the help.
20 August 2021 4,839 3 View
I am planning to do a study on emotional intelligence of managers...
24 July 2021 9,430 7 View
Post Covid 19 the scenario in India has changed and some of the private insurance companies are providing coverages for mental disorders. So My question is what mental disorders are covered in...
04 January 2021 6,709 10 View
I use Fugene-3ul/well, pclEco- 0.8ng and polybrene 2ul/ml from 5mg/ml stock. I usually spinfect T cells that I have activated a day before with anti-CD28 and anti-CD3. I use MigR2 plasmid with my...
08 December 2019 3,791 3 View
I'm cloning a fragment of 3200 nts into plasmid. The cloning was successful, however, 02 amino acids were mutated. Now I want to fix these 02 aa by site-directed mutagenesis technique using...
08 August 2024 4,645 2 View
After performing symmetric PCR, PCR purification was performed. Afterwards, asymmetric PCR was performed using the PCR purification product as a template, but no ssDNA band was confirmed in the...
08 August 2024 1,668 3 View
How do soil microflora interact with plant roots and influence plant nutrition, health, and productivity?
06 August 2024 9,618 3 View
i have sorted anti-NP specific plasma cells from bone marrow of C57BL/6 mice at certain times after immunization with variable counts and isolated total RNA using TRIZOL method for RT-PCR using...
05 August 2024 8,835 1 View
In order to show people the beauty of control and enhance enthusiasm for learning control theories, are there any good simple systems or platforms to recommend?
05 August 2024 10,034 1 View
I aim to be as skeptical as possible regarding whether a pair of orthologous genes results in the same phenotype in their different but related bacterial organisms under similar environmental...
05 August 2024 6,787 4 View
I am performing ligation of the plasmid and a target gene. The steps I have taken are: 1. Double digestion of the plasmid and target gene 2. Ligation of the plasmid with the target gene 3....
05 August 2024 2,570 3 View
Hi guys If anyone is currently working on aging cells, you guys would like to give me some advice. I'm testing against biomarker (SA-beta-Gal), I encountered a false positive in the control group...
02 August 2024 6,735 1 View
I am currently researching the impact of environmental toxins on children's health and would greatly appreciate insights from experts in the field. If you are an expert or researcher working on...
02 August 2024 4,474 2 View
I have been attempting to extract DNA from Bacterial, Fungal and Yeast banked samples (>1e7 cells) using Prepman Ultra reagent and I seem to be struggling to obtain a sequence. Although the...
01 August 2024 2,079 0 View