The difference of Tm < 5oC of two primers can let you easily decide/choose a Ta (annealing temperature) for both primers to anneal to the template.

For example, if you have one Tm = 45oC (Primer 1), and another Tm  = 62oC (Primer 2), then it is very hard for you to set a Ta for both primers to anneal during PCR. If you set Ta at 60oC, primer 2 can anneal, but primer 1 may not anneal to the template. If you set Ta = 43oC or primer 1 to anneal, due to the high Tm of primer 2, primer 2 can render non-specific annealing to the template.

The melting temperature controls the binding of the primers to your template DNA. By defintion, at melting temperature 50% of the primer molecules are bound to their corresponding target sequence. If the difference in melting temperature between the two primers is too high, it might be difficult to find experimental conditions where both primers can bind to their target.

Melting temperature can be calculated by a vast array of software using very differents algorithms and their results can differ, even if applied to the same base sequence. There are whole philosophies about how to calculate melting temperature in the most realistic way. As a rule of thumb, for primers up to 20 bases in lenght, take 2°C for each A or T and 4°C for each C or G. This will be accurate enough for many cases.

I once had to use primer pairs where some software gave me a difference in melting temperature of 20°C. These were primers targeted to the exact 5'- and 3'-end of an open reading frame and it was necessary to include restriction sites at each of the primers' 5'-ends. So there was very little to no room for varying primer sequence. Luckily, the method was successful anyway, I got the desired DNA amplification. ;)

The difference of Tm < 5oC of two primers can let you easily decide/choose a Ta (annealing temperature) for both primers to anneal to the template.

For example, if you have one Tm = 45oC (Primer 1), and another Tm  = 62oC (Primer 2), then it is very hard for you to set a Ta for both primers to anneal during PCR. If you set Ta at 60oC, primer 2 can anneal, but primer 1 may not anneal to the template. If you set Ta = 43oC or primer 1 to anneal, due to the high Tm of primer 2, primer 2 can render non-specific annealing to the template.

Hi There

basically the above answer. Ideally you want to keep your forward and reverse primer within 2C of one another so that the the PCR annealing temp is compatible and specific. That annealing temp should be 55C-60C for 3 step PCR and for primers with a higher Tm, e.g. 65C you can use a 2 step PCR in which after an initial denaturation cycle the annealing and extension temp are combined into one. Dont design primers with a melting temp of < 50C or greater than 70C for optimal PCR efficiency

In terms of programs for primer design, there is primer 3 or primers can be designed manually by eye based on a few simple rules ( see link to my word file in drop box)

Regardless of whether you design optimal primers by eye or using a program that takes into account base composition and/or salt concentration, primers should be screened for self annealing (hair pin loops) and partner annealing (primer dimers). All such matters are covered in the documant provided which incorporates links to free on line programs that perform such functions. Let me know if you require further help

https://www.dropbox.com/s/hjtem98mre9foot/PRIMER%20DESIGN%20document_updated%200414.docx?dl=0

Agreed with the above. Nowadays, the software are 'smarter' and they give you primer pair which does not have much difference between their Tm. To avoid time-consuming PCR optimization, primer pairs should ideally have Tm difference of 2C and max 5C. However as stated above, higher degrees of differences have been reported to work as well. 

If this is not a hypothetical question ...

cut some bases from one side of the primer with high annealing temperature, re-check for dimers, cross dimers, hairpins ... if it's not satisfying: try it at the other end of your primer with high annealing temp. 

and if this also will not work ... a dirty but well working trick:

place mismatches in one or both primers (change a nucleotide, do not insert one) ... maximum two, preferably in the middle or at the 3' side. Get in mind, that this mismatches will definitely not bind to your target sequence, the predicted annealing temp has to be decreased 2/3 °C for a nucleotide changed to A/T or G/C. Having limited options to create a primer, this can give you the last chance to get a fitting pair.

I have two primer with around 20 c difference,  How I can optimize the rxn?  

Just redesign the primers so that they are within a Tm difference of 3C. Then your PCR will work

@ Rawan,

If you have two primers with around 20C difference in Tm as you stated:

1. Make another pair of primers as suggested by Laurence.

2. If you must use this pair of primers (or want to try out): Choose a Ta (annealing temperature) closed to the lower Tm of one primer. For example, if you have two Tm, one is 40C and one is 60C (difference is 20C), I would try out 40-42C Ta. With luck, you might get your PCR amplified [if no obvious non-specific binding between the primer (that one with Tm=60C) and the template].

3. Please let us know the result if you do try out.

Rawan :) 

I think that PCR optimization will direct you, your knowledge about  proper difference between 2 primers or annealing and melting temperature helps  but doesn't restrict you, at the end lab work is the judgment, optimize the annealing tm from ( 50-70) and you can add DMSO, may help.  

then if you get a good results, go ahead  

if not, redesign as @laurence and @Yuan-Yeu Yau said, you can help your self from the beginning. 

I have commented 2 x previously so I will just emphasise one or two more things

• A basic pre requisite for specific and efficient PCR are primers that have compatible Tms which I personally take to mean within 3C of one another although some protagonists think that a 5C difference is on the edge of acceptability; but certainly no more than this difference
• In terms of making such primers primer 3 and primer BLAST are 2 programs that incorporate this compatibility into their design algorhims
• If you do need to design manually by eye although it is good to select regions with a lack of repeat bases etc ( as described in my document) the one thing you can vary to render primers more Tm compatible is primer length: in other words if one primer for example is 20 bases with a predicted Tm of 60C Your supposing primer could for example be 24 bases if AT content in the relevant region is slightly higher or 18 based if the GC content is higher. 
• Try not to go below 18bp fir reasons of efficient and specific binding or above 25bp in order to minimise secondary structure and non specific binding
• For primers with Tms > 65C it is acceptable to deploy 2 step PCR in which the annealing step and extension step are the same duration as the std extension step ( 20 sec to 1 min) and Tm-2c in terms of elected temp
• Finally for primers with Tm differences ~or slightly more than 5C something called touchdown PCR will probably work better than single annealing temp 2 step or 3 step PCR
• NOTE: Touch down PCR is NOT suitable for primers with Tm differences > 10C 
• only primer redesign will work

If the difference is about  C, that will be acceptable for PCR reaction 

@dropbox: link not found

@ hair pins, primer dimers, cross dimers: netprimer is my favourite (!attention! in normal java installations, the url has to be set on the whitelist of java) http://www.premierbiosoft.com/netprimer/netprlaunch/Help/xnetprlaunch.htmle)

@Laurence Stuart Hall (next post): thx for maintaining the file. It is a good topic for anyone to get informed about this topic and can be a valuable source even for todays google searches.

Apologies Jorg. This link is now defunct and I havn't been back to older answers to amend

Find attached an updated version of the primer design doc in drop box

Yes I have used and find net primer excellent too

Foward: GAGAAGTTAATTAAACAGAAAG

Reward: ATCCATCTGAACTCGCGCATGCTC

I checked this primer in blast primer and saw the Tm so different between the two primer. I am confusing about chosing the annealing temperature.

Anh Tai - That's a really big difference between those primers when I calculated it to be 22.6C (and should not be more than 5C difference between the two).  I would suggest re-designing your primers since the GC content in your forward primer is only 27% (which is affecting the Tm) and typically should be around 40-60%.  The Tm of the reverse you show here is ~73C so you might run into issues with secondary annealing.  Best suggestion is to re-design your primers but optionally if you wanted to, you could run a temperature gradient and see what might happen

If the Tm difference is wide lets say 10 deg between 2 primers can we do a step up PCR??

What if I have a primer tm that is 59.5 and another that is 64.3? would those primers be able to bind if i utilize 60 as the annealing temp ? thank you

Adrianne Brown ...Yes it should. But you can give it a trial.

FOWARD / CTAATTTAATATGAACTT

RIVERSE/ GACTTTTAAGGCTCTCTCTCT

PROBE/ TTATATGGGAAATTTTAAAAAG

can someone help me to calculate the annealing temperature of my RT pcr

please

http://biotools.nubic.northwestern.edu/OligoCalc.html

Usually the annealing temperature refers to the part of the primer that is annealing on the DNA. I do not design Taq PROBES, but I assume that it is a similar process.

https://bitesizebio.com/10041/designing-qpcr-primers/

If I have more than 4-5 degrees difference between primers I use a touchdown approach. Starting with a Tm 10 times higher than the highest Tm, then lowering by 2 degrees at each cycles until I meet the lowest Tm, and then staying there for 21 cycles.

FOWARD / CTAATTTAATATGAACTT 37

REVERSE/ GACTTTTAAGGCTCTCTCTCT 52

PROBE/ TTATATGGGAAATTTTAAAAAG 44

I used Snapgene and just hovered over the sequence and it calculates the Tm: it works for my PCRs.

The lowest Tm I use in my PCRs is 48 (no less than 15 Nt). Probably a minimum Tm of 50 is a better deal.

https://www.idtdna.com/pages/education/decoded/article/designing-pcr-primers-and-probes

Login then click TOOL click OLIGO ANALYZER

Dear Dr. Yuan-Yeu Yau ,

Hi. Do you have reference about:

The difference of Tm < 5 oCof two primers can let you easily decide/choose a Ta (annealing temperature) for both primers to anneal to the template.