Hello
I have been using the Agilent quick change lightning kit to generate mutations. I have recently designed a 63 base pair complementary primer (as per the manual) to create 2 mutations within the same primer. The primer was purified as per the kit suggestions.
Tm = 99.4 degrees C, Bases = 63, GC content = 69.8%
Primer Sequence 5' to 3':
GGCCTGGGCAGTCCGGATCACCTCTGCAGCTCCCCACCAGGCCCCGCCAGGAAGGCCTCAAAC
Complement 5' to 3': GTTTGAGGCCTTCCTGGCGGGGCCTGGTGGGGAGCTGCAGAGGTGATCCGGACTGCCCAGGCC
I used an additional 1.5ul of DMSO with my reaction and used the following PCR program. I did 16 cycles.
95 C - 2 min
95 C - 20 Sec
68 C - 10 sec
68 C - 7 min (My plasmid is around 11KB)
68 C - 10 min
I did a 1 hour DPN digest, since from past experiences 5 min DPN digests give me lots of parental unmutated colonies. I transfected 5 ul of the above to 45ul of Gold competent cells. I only had a few colonies on the plate. But none of them were mutated. Not even one of the two mutations. Could Someone please give me any suggestions on how to get the mutations.
Thanks in Advance!
Cheers
Pranetha
Dear Pranetha,
quikchange lightning site directed mutagenesis troubleshooting is found here: https://www.agilent.com/cs/library/usermanuals/Public/210518.pdf
Good luck
Are you using chemically competent cells? 11 kb is kinda large for chemically competent cells, especially since it's not supercoiled DNA (and it's unligated as well, if I remember the Quikchange method correctly)
If you can, I would switch to purifying the DNA and using electrocompetent cells.
Also the protocol I'm seeing for Quikchange II seems to suggest 1 minute/kb of DNA, meaning you might need an 11 minute extend time for efficient amplification.
Try to read and use the modified protocol which has been proved much more efficient. The attached file is my lab protocol which is much easier to follow.Article An efficient one-step site-directed deletion, insertion, sin...
- Badges
- Science method