Hi everyone!
Although I am aware of the existence of several tools for predicting miRNA targets, I would like to know if it is possible to use only blastn to this end in case of plant miRNAs. As far as I can understand, matches between plant miRNAs and their targets are perfect or nearly perfect and therefore this feature would permit the utilization of blastn to find miRNA targets.
Cheers!
It would - but there is a very high false positive rate - IE a lot of targets although they match are not functional.
No. Blastn finds matches which are similar to the query sequence. miRNA targets are complementary to the query sequence.
Hi Christian! You're right, but if we consider the complementary sequence of the miRNA of interest? For example, if I have the following sequence UUAGCGCGUUAAGAGGAGAGACGCGCU and use its complement AAUCGCGCAAUUCUCCUCUCUGCGCGA in a blastn search? Which are the most appropriate parameters of blastn to get the targets?
Dear Marcio,
You can use blastn to predict miRNA but the blast parameter should be stringent with high evalue, percent identity and query coverage. You can use miRNA db as query and your input seq as you database sequence. Your word size for BLASTN analysis must be 7 and to avoid high false positive rate you can have stringent criteria ie 95% identity, 95% query coverage, etc. Hope this information is useful to u.
Best Wishes
- Badges
- Science topic
- Similar topics
- Biological Science
- Biochemistry
- Biomolecules
- Nucleic Acids
- RNA
- Small RNA
- microRNA