From a DNA sequence, how can one confirm/make a protein sequence is correct (frame shift error, correct ORF strand and position ?) for sequence submission in GenBank.
For Example
DNA sequence:
CGGTTGGCGTCGTCGTGCTCGAGGAACGGAATCAGCGACGCAGCAACCGAAACTACCTGCTTCCGGCGATACGTCCATCAAGGTGACGTCTTCCGGCGCCTTGACGGTGAATTCGTTCAAGTGACGAACAGCTACCAGCTCGTCGATCAGGACTTTCTTGTCGTTCATCGTGGCCGAAGCCTGAGCGATCACGTGATCAGCTTCTTCGATGGCGGACAGGAACACGATCTCGTCGGTGACCAGCGCGTCTTTCACCACACGGTACGGGCTCTCGAGGAAGCCGTACTGGTTGGTGCGCGCATAGGCAGCCAGGGAGTTGATCAGACCGATGTTCGGACCTTCCGGCGTTTCGATCGGGCAAACACGACCGTAGTGAGTCGGGTGAACGTCACGAACTTCAAAGCCGGCACGCTCACGAGTCAAACCGCCAGGGCCGAGTGCAGAAACACGGCGCTTGTGGGTGATCTCGGACAGCGGGTTGTTCTGC
protein sequence:
QNNPLSEITHKRRVSALGPGGLTRERAGFEVRDVHPTHYGRVCPIETPEGPNIGLINSLAAYARTNQYGFLESPYRVVKDALVTDEIVFLSAIEEADHVIAQASATMNDKKVLIDELVAVRHLNEFTVKAPEDVTLMDVSPEAGSFGCCVADSVPRARRRQP
from this if the protein sequence is correct for submission or need correction (like correct ORF, sequence position and feature table) and which tools will be used for correction. Please help me out in regard of this query.
u go to expasy-translate bioinformatcs tool if u find stop codons in all frame shifts then it is not worth submission in gene bank. i did dis one of the frames is not having stop codon and i think it can be submitted to gene bank and then what kind of querry they will you (R L A S S C S R N G I S D A A T E T T C F R R Y V H Q G D V F R R L D G E F V Q V T N S Y Q L V D Q D F L V V H R G R S L S D H V I S F F D G G Q E H D L V G D Q R V F H H T V R A L E E A V L V G A R I G S Q G V D Q T D V R T F R R F D R A N T T V V S R V N V T N F K A G T L T S Q T A R A E C R N T A L V G D L G Q R V V L)
this is protein sequence
Yup agreed dear, but in the same line another frame also observed by expasy-translation tool which is as (QNNPLSEITHKRRVSALGPGGLTRERAGFEVRDVHPTHYGRVCPIETPEGPNIGLINSLAAYARTNQYGFLESPYRVVKDALVTDEIVFLSAIEEADHVIAQASATMNDKKVLIDELVAVRHLNEFTVKAPEDVTLMDVSPEAGSFGCCVADSVPRARRRQP)
so two sequence but which is the correct one and what is the position, strand and how to create a feature table of gene as well as protein?
Your sequence is partial (3 and 5). I have checked your sequence and observed frame shift problem in this sequence. Better to remove frame shift and then translate it. I will suggest to use DNAstar.
Yup, any software or tool to remove the frame shifts problem from the sequences ? because manually to is difficult to judge the accuracy.
Hi Muhammad,
first of all it would be good to know how you obtained the sequence?
If you simply sequenced a PCR product, then what would you expect to get?
I usually used expasy (http://web.expasy.org/translate/), which allows you to get three different ORFs in both directions. Especially the last is very helpful if you are dealing with unknown sequences. However, screening your sequence results in very short peptide sequences. Either there is indeed a frame shift problem or you have a reading errors from the sequencing step. To avoid the second you should repeat sequencing/PCR (or whatever you do to get your sequence) and compare them all.
Hope this helps a bit. Best regards.
Dear Enrico,
Yup i have performed sequencing from LGC Genomics Germany and it is PCR purified product. I want to do two things..
1> as you described about ORF, my query is that which ORF is the best among all six to create CDS for translated gene sequencing ?, for sequence submission to GenBank.
2> and facing frame shift error in the DNA sequence then how to remove these?
If you use the protein blast tool from NCBI, your second translation gives 99% homology with RNA polymerase B subunit from pseudomonas.
Your first translation gives poor homology.
Day before yesterday, i have sent you NCBI webinar link, if you watch this presentation you can see that if you can not judge CDS the NCBI can also do this for your sequence. NCBI is organizing such kind of webinars to enhance understanding. In addition, If you need help using BankIt to annotate your sequence(s), please contact GenBank Users Services at: [email protected] and include your query.
Yup reading all literature now, then try again to create CDS of sequences
Then, how to conclude which is the correct reading frame?, that is the question as mentioned above. ORF may be like that ?
1> not containing much stop codon
2> must be longer in length than others
3> or used whole translated sequence or only a ORF (start to stop codon)?
these things mentioned regarding healthy ORF in literature if else then share please
Perform homology searches for each frame in NCBI..if all the frames showing homology against one protein then select the one with the best homology
Dear Masood,
thanks, yup good way to predict the correct ORF but one confusion again
> if any of the sequence have partial 5 or 3 end or both protein, then sequence may be considered for Genbank submission or
> need a complete reading frame (from start to stop codon) for a CDS/Protein sequence for GenBank submission ?
which need complete DNA sequence.
NCBI blast x and blast p homology search guide towards correct ORF. As long as sequence length is concerned you can submit partial (3 or 5 or both) sequence but it should be more than 200 bp. There are many causes for frame shift but i personally observed because of the contamination from the 3 and 5 ends. Better to trim the low quality reads from both sides by homology search (blast x and blast p). Generally, the sequences obtained by designing primers are partial (5 and 3). Until you go for full length by commercially available kits otherwise you can only get partial sequences (5 and 3). In this case better to remove the low quality reads and the rest of the sequences should be used as ORF, be careful the sequence should not contain stop codon.
Best of Luck
Dear Naveed
I will endorse Abid Hussain's answer...submitting to Genbank sometimes can be a nightmare...I have gone through it
All the best!
Thanks again dear Abid,
I got the point to annotate and trim the sequences for GenBank submission.
Stay blessed.
Dear Naveed,
In a simple way, as soon as you get your DNA sequence done, edit the 5' and 3' ends which contains Phred score of
Dear Rajkumar,
thanks for comprehensive comments, even thought, i got the solution of my query but your comment revise my knowledge and helpful for reader.
Dear Rajkumar,
That was quite a comprehensive answer.
I learnt a lot from it even though I had done a similar thing before.
Best wishes
- Badges
- Science topic
- Similar topics
- Computer Science and Engineering
- Bioinformatics
- Bioinformatic Tools