Hi Najmeh, I have had this problem as well.  There are a couple possible solutions.  If you want to try to save the current read, you can try reading it by eye focusing on the higher peaks (your primary sample).  While this may work, you could also end up making a lot of mistakes.  If you need a cleaner read, I would start over with your PCR.  Some things to try: 1) Blast your primers in NCBI or Ensembl to be sure they only have one full-length hit so you are only amplifying one sequence in the PCR. 2) Try your PCR at different annealing temperatures.  You want to use the highest annealing temperature that produces a quality band.  The only way to know the right temperature is to run the PCR reaction at several annealing temperatures.  3) Instead of purifying your whole PCR product, gel purify the product.  Run it out on a gel (usually 1.5-2% agarose) and cut out the band with a razor blade.  It is tedious, but gives a better result.  I like to use the Qiagen gel purification kit for this step.  4) Be sure to send one sample for sequencing with the forward primer and one with the reverse primer.  Sometimes one or the other will give you a better read.  Good luck!

There can be many reasons: Improper handling during template prep. for seq, or low throughput of the technique used, time gap between amplification and sequencing (happened with me as well) so on and so forth. As far as your present results are concerned did you BLAST your seq, are they showing any seq similarity (applies only to conserved primers).

Dear Satej Bhushan

Between DNA Amplification and Sequencing there was just a week and i kept them in -20 c .  I've just BLAST Primers and check in ensemble. they were ok. but now i don't know what can i do exactly?

Dear Ahangari

I was actually talking about BLAST the sequence that u got after the sequencing . You have to see how different those are from the ones in db. That should give you some idea.

Dear Sateji

You can not see the small amount of unspecific bands on gel electrophoresis. So it is better to do Real Time PCR with same primers to verify the specify of your primer.

Best regards

Dear Bhushan

I did As you told . Until now that i did it for some results, they are in Red, with 91% to 97% identity. so?!

Based on your picture the sequence doesn't look that bad. You would always get some background due to elongation or reading errors during the sequencing reaction. Alternatively it is possible the noise is real and can be due to your template not being uniform (what were you amplifying?) or to errors introduced during PCR amplification (even high fidelity enzymes would have some level of error). You can try and clone your product into a plasmid and then sequence few individual clones. Did you gel purify your product or just sent the total reaction for sequencing?

As stated by Yoav, cloning is the best way to solve this.  However, I am aware that this can take some time.  Are you sequencing with the same primer(s) you used for amplification?  If so, you could try a nested primer.  Same question as above- did you do a clean-up or just use the PCR product directly?

Did you clean your post PCR products? I had the same problem.

Now I clean the PCR product with EXOSap (2ul every 5ul of PCR product) and the sequencing are perfect.

You had better use exo-sap purification by the time you should check your instrument  conditionts with using pagem.

Najmeh, 

For PCR products, you can always ask the sequencing provider to clean up the PCR product prior to sequencing. In case, they have done this already and you are still getting this noise, then your PCR product is not specific, even though you are getting a sharp band. 

How much product have you run on the gel for testing purposes. Could you share that picture please? 

Dear Friends

Thanks for your suggestions. Actually i ordered sequencing without purification. I attached one of pictures of Products gel electrophoresis. I used sequencing for mutation screening of GJB2.

Dear Najmeh,

Is there any possibility that the genotype of your organism is a heterozygous? Because if it is, you will get two different DNA template (the PCR product) for your sequencing. In such case, you will see that type of sequencing noise results since you sequenced directly your PCR product. I strongly suspect this is the case since in some points you get equally strength reading for the two alternative nucleotides [i.e. the GGGGGG stretch at the beginning are probably read as (G/T).(G/T)(G/A)GGG] indicating the presence of more than one templates.

In my opinion, you have at least two different DNA sequences from two alleles in the PCR product. The only way to confirm this is to clone the PCR product and sequence at least five (5) colonies. You can provide the PCR product to the sequencing company and ask them to clone the fragment before sequencing and pick five colonies for sequencing. You probably end up with 3 sequences of the template 1 and 2 sequences of the other or at least 4 to 1. By doing so you will probably be able to capture sequences of the two fragments in the new sequencing results. It should cost you a bit more (depending on where you are and the company) for cloning and pick five colonies services, but it will save you some cloning headaches and will give you more accurate results.

Good luck...

Purification method post PCR matters.. may want to use exosap, or optime it.

yes, it can be frame- shift but you have to check reverse template cycle sequencing result. if  there is a noise in the same bases it must be 35 delG mutation. You should look at CCCCCC on the reverse template..

Your PCR sample contains two different DNA products. Have you checked your primers on the genome whether they bind to different posiyions (as you should always do anyway)? You can still do that. In any case it is not likely that the patterns are derived from a heterozygous organism as in this case you should expect very similar patterns with single double peaks. To make use of the sequence I would take the high peaks as one DNA sample, the lower as another one. As sequencing should always be done at least twice and in both strands you can use the data after further experiments. But you must resisigne and test your primers. The sequenced sample basically looks clean enough for sequencing although it will be  more informative o see further downstream patterns.

Your PCR sample contains two different DNA products. Do Exo sap treatment to avoid this.

This has happen in my case, the problem was the sequencing sample contain same genomic sequences and the primer read both at similar period. Then i design a specific primer to rule out this situation for my next sequencing. 

Your primers or sequence sample might be contaminated (forward with reverse or other way around) see if you can read the same sequence underneath the other one but reverse complement. Did you cut and isolate your product from gel? Try SAP-EXOnuclease to remove excess primer on PCR mix. Might also try a higher Tm for the sequencing reaction.

Good luck

Hi Najmeh, I have had this problem as well.  There are a couple possible solutions.  If you want to try to save the current read, you can try reading it by eye focusing on the higher peaks (your primary sample).  While this may work, you could also end up making a lot of mistakes.  If you need a cleaner read, I would start over with your PCR.  Some things to try: 1) Blast your primers in NCBI or Ensembl to be sure they only have one full-length hit so you are only amplifying one sequence in the PCR. 2) Try your PCR at different annealing temperatures.  You want to use the highest annealing temperature that produces a quality band.  The only way to know the right temperature is to run the PCR reaction at several annealing temperatures.  3) Instead of purifying your whole PCR product, gel purify the product.  Run it out on a gel (usually 1.5-2% agarose) and cut out the band with a razor blade.  It is tedious, but gives a better result.  I like to use the Qiagen gel purification kit for this step.  4) Be sure to send one sample for sequencing with the forward primer and one with the reverse primer.  Sometimes one or the other will give you a better read.  Good luck!

Dear Heather E Doherty

Hi, Many thanks for your suggestions. As you mentioned, I Blast my primers again in NCBI and check it in Ensembl, they were ok. I used annealing temperatures in a gradient manner and select the most sharp bands and set that temperature as the final temp.  But i didn't cut and purify those sharp bands.

Regards

I agree with Heather E Doherty. The first part of the correction is check your primers. A clean template means a clean reaction. However, your primers should not mess up with your clean template by not annealing to it. Some times genomic DNA contamination becomes a matter of big concer during amplification. So, take care. Best.

Dear Najme,

As other people said, in my experience it is better to first check your primers, second purified your PCR product (it is better than gel purification because you will lost some DNA in this case but of course pcr product should be checked by gel), and for sequencing I think the fwd and rev primer are important and also the amount of your PCR product and total volume of both, depend on where you send your sample for sequencing. for example I send 80-100 ng of DNA in 5 microgram plus 5 microliter of each primers, and sequencing was OK.

I hope you can solve your problem ASAP.

All Dear Friends

Many thanks for all your helpful suggestions again. I checked the fwd and rev primers again and they were good. As i contact that company, I found that they forgot to synthesize new primers in order to my request!! They used previous primers which i have sent them with the PCR products! Before this they suggested me to use new primers with the higher quality. It may be possible that my previous primer has been degraded during the time of sending. I should wait for their response!

Best regards

Hi Ms Najmeh Ahangari,

You may follow the following two things:

1) Design another set of primers

2) Cloning of your PCR product.

Hope these will work.

Best of luck!

It's not because you see a sharp band on your agarose gel that you have a clean product. It is possible there are non specific amplicons but that they are not present in a high enough concentration to be seen on the gel. Nevertheless, they are present and could be the reason you have a double sequencing profile. Only way to find out is to cut your specific amplicon from the gel and continu working with that.

In your profile, does the noise continu over the entire fragment or does it stop after a while?

Hi, Najmeh, Looking at your data it looks that surely something non specific is getting amplified . As you are not getting any separate non specific band it might be of similar base pairs of specific band. I would recommend you to 1st check with your primer sequence . Then put the gradient PCR with different annealing temp and if possible with different Mgcl2 conc. Select the best combination of both . Always go for gel purification by cutting specific band instead of PCR purification. Good Luck

Hi  Najmeh. It would be interesting to try to read the sequence of the noise. I see in your sample that it should be possible.  For your sample the sequence would more or less than be "TAATTAGCAAATAACCCAATTCAGTGACATTCATGCAGG". Try to do this for a longer part. If you don't see a second signal underneath the presumably correct signal, than use the base from the correct sequence. If you have it, than blast the sequence in Genbank (NCBI database) or elsewhere. The results can give you interesting information: 1) the "noise sequence" is a contaminant or an undesired secondary product from your sample (as somebody already mentioned, sometimes you do not see the second band on the gel. Or, another possibility is that you have two PCR-products with the same length. This is particularly possible when you use primers to amplify a conserved DNA-part like the ribosomal DNA. A contaminant can give you the same length of amplicon as your sample). Optimising the PCR-reaction can help but maybe it will be needed to design other primers. Another solution is first cloning your sample before sequencing; 2) the "noise sequence" is also correct and thus (almost) completely the same as the sequence from the higher peaks (this can happen when a longer stretch of the same base, like 'GGGGGG', which is present in your sequence by the way, is causing troubles during cycle sequencing resulting in the reading of two or more shifted sequences. It can easily be noticed when the double signal suddenly appears in the middle or somewhere else in your sequence). In this case sequencing using the reverse primer can help to obtain the 'rest' of the sequence (I however don't think this is your problem as I do not see a shift in your sample): 3) the "noise sequence" is the complementary reversed sequence of your sample (this happens when for example you have purified the sample directly in the tube but purification was not complete. This means that part of the primers are left in the sample causing sequencing of both DNA strands. Gel purification would solve this problem). I hope this will help you. Good luck.

Dear All

Many thanks for your suggestions again. As i told before, I blast the primers more times. The order i made was good. I got new re-sequencing results today that  they have been done by new forward primer. They are better than the previous results although there are some noise again. But i should take more times to analyze them to find mutations.

Regards

Dear Najmeh,

I checked the sequence chromatogram. I believe that it is not a noise or contamination of PCR product. I checked both sequences and found that the main peaks belong to the plus strand of GJB2 sequence and the peaks in background belong to the minus strand of GJB2 sequence. I had same problem rarely as well. It can be as a result of using high primer concentration in amplification step, contamination of forward primer with the reverse one or vice versa, non-specific binding of the primer to the complement strand and technical problems in sequencing procedure.

Regards

Hi Najmeh.  If the contaminating sequence in the complementary strand, there are three ways to help reduce this: 1) Be sure to send sequences with only one primer, 2) Use less primers in your PCR (0.5uL each of 10nM primers is plenty for a 25uL PCR reaction), and 3) Use a high quality purification kit such as Qiagen's "Qiaquick PCR Purification Kit".  Number 3 will remove any remnants of primers from your PCR so that you are not getting background from the complementary strand.  Good luck!

Another way of solving this problem is to use a nested primer for sequencing. Gel purification is not necessary in this case, but use Heather's advise to clean your PCR product to remove the PCR primers.

In addition to my previous message. Some primers perform much better then other primers in a sequencing reaction, maybe this is true for the PCR reaction as well.

So in your case the reverse primer gives a strong signal even if the concentration of this primer is very low after cleanup. To solve this you could start reducing the reverse primer concentration in your PCR reaction and increase the forward primer concentration in your sequence reaction.

Hi. I've got a problem as well.

I've sequenced both forward and reverse reaction for my primers but the forward shows a heterozygous mutation and now i'm not sure whether to disregard the mutation  since reverse is not showing it. this is happening to some of my exons as well. see attachment

thanking you in advance

To me it looks like an artefact in your forward sequence.

If it was a true heterozygous mutation you expect the G peak to be lower (50%) compared to a normal case.

To realy be sure you need to run a control sample, or more than one control sample, if you see the same, you know this is an artifact.

It looks like the PCR product contains an aspecific signal, that gives a more prenounced A signal in your forward reaction compared to the reverse sequence, also here an A signal is present to a lower extend and not right on top of the G-peak (closer to the sequence primer probably causing a shift in the electrophorogram).

Thank you so much Martin for your feedback

Most likely your primers have a secondary binding site with lower efficiency. You did not say how you choose your primers (did you make a temperature gradient to find the best conditions? Did you test your primers on the genome whether they have additional binding sites? These are two parameters obligatory in my lab). Your DNA looks clean enough (even though it is probably the more initial part of the sequence). What you should always do for sequencing  is to carry out a second PCR reaction with nested primers, this will almost certainly help to avoid your problems. In addition, adequate experimentation requires ALWAYS to sequence also the opposite strand, which will help you solving problems which can occur due to sequence-specific reaction problems, even with the best DNA and best primers. I am sure considering both points you will solve your problems.

I've designed the primers using Primer3 and NCBI primer blast. We always start with gradient PCR (40-65) and choose the best temperature. The PCR product was clean, did not show primer dimers. However, the primers that i've designed with primer3 had dimers and i'm still optimizing with no luck.  DNA was quantified immediately after extraction and it was indeed clean. I will try to use the nested primers next time and see if my problem will be resolved. Can you kindly recommend a tool that I can use to check if my primers have additional binding site?  Thank you so much for your feedback. 

Respected Professor Heather E Dohert,

Greetings!!!

            We have successfully amplified and cloned the Mouse gene with 1700bp in the pET30a (+) vector. It was also confirmed by Restriction digestion and PCR using pET series specific primer and gene specific primer. However, when the same analyzed by sequencer, the forward read was failure to read when other clone got read. For your kind information that reverse got accurate read.

Kindly give your suggestion to overcome the problem.

Thanking you,

Regards,

M.Kannan