I have done a lot of ITS amplifications from plants and fungi and have seen multiple bands only when I had a contamination either from the material or from (dirty) primers. Make sure that you have an new batch of primers, run a control with primers only and no DNA to see if the primers are not contaminated. Depending where your material is coming from you might have other material (fungi/bacteria/plant) in it. My suggestion is that if you cannot get a single distinct band to clone and sequence all the bands to find out if you have a contamination and where it is coming from. I use the primers ITS1 (tccgtaggtgaacctgcgg) and ITS4 (tcctccgcttattgatatgc) (White et al 1990) for my PCRs on fungi. Here is a neat list of primers if you want to try a different set: http://www.biology.duke.edu/fungi/mycolab/primers.htm

Primers that we normally used in the lab were for purposes of basidiomycetous yeast identification; with these one band, which will approimate the partial squence size of the D1/D2 region is normally observed.I don't really have any background on the identification of filamentous fungi.With sequening you should be able to determine if you obtain a partial sequence or otherwise.

I have done a lot of ITS amplifications from plants and fungi and have seen multiple bands only when I had a contamination either from the material or from (dirty) primers. Make sure that you have an new batch of primers, run a control with primers only and no DNA to see if the primers are not contaminated. Depending where your material is coming from you might have other material (fungi/bacteria/plant) in it. My suggestion is that if you cannot get a single distinct band to clone and sequence all the bands to find out if you have a contamination and where it is coming from. I use the primers ITS1 (tccgtaggtgaacctgcgg) and ITS4 (tcctccgcttattgatatgc) (White et al 1990) for my PCRs on fungi. Here is a neat list of primers if you want to try a different set: http://www.biology.duke.edu/fungi/mycolab/primers.htm

Sometimes comes from nonspecific binding or might be due to primer dimer

We got single band (about 500 bp) using ITS 1 and ITS 2 for Termitomyces heimii. You can refer to this publication.

Article Sequence analysis of the ribosomal DNA internal transcribed ...

I usually get single bands approximately 500bp for candida and cryptococcus using ITS1 and ITS4 form White et al, 1990.

Contamination could be an answer, but it is not unusual that incomplete homogenization of rDNA repeats will product bands of different sizes. There are some papers dealing with this intragenomic variation. For example:

Simon, U. K., and M. Weiß, 2008 Intragenomic variation of fungal ribosomal genes Is higher than previously thought. Mol Biol Evol 25: 2251–2254.

This incomplete homogenization could have several causes, e.g., differences between rDNA loci, differences among populations, etc. So, exhaustive analysis of intragenomic variation is needed before using any repetitive DNA for phylogenetic analysis.

I worked on microalgae and I got approximately 600 bp amplicons. Additional bands may be due to contamination of starting material or by the presence of pseudogenes. Your additional bands are too big for primer dimers and if you are working in stringent conditions I do not think they could be non-specific amplification products.

Thank you everyone for your answers.

I am working on maize. I have two negative controls: one without primers and one without DNA template but with primer. Both negative controls showed no band.

sequence all bands you can see on the gel and you will know everything you need :) Its easier to do this than think "what the hell are these bands on my gel..."

Thanks, Tomas. We have all the bands cloned and waiting for the sequencing results. That is just a pretty rational thing to do. ^^

I usually get one single band when I use ITS-1 and ITS-4 primers for pure yeast colonies.When there is genomic DNA of mixed cultures there is possibility of multiple band amplification as it happened for me.So, its always better to get pure single colonies before ITS sequencing...