I run real time sybr green pcr (rat hippocampus) and I came accros a primer dimer situation. I use 42.5 nM primers in final concentration. I am getting PDs in whole range of concentrations, from 10 ng to 0.001 ng. I can attach my primer sequences if needed.
5 HT1a (F) – gtcctgcctttctgtgaaagca
5 HT1a (R)- tatggcacccaacaacgca
p11 (F) – tgctcatggaaagggagttc
p11 (R)- ccccgccactagtgatagaa
β-arrestin (F) – aagacaccaacctggcttcc
β-arrestin (R) – taggacgaaaggtagctccac
I typically use primers in range 0.2-1.0 uM so you are already using a very low amount of primer.
Have you tried a hot-start polymerase?
Hi,
There might be possible that your primer or water is contaminated. Are you keeping NTC (non template control-without cDNA)? If not then next time you run NTC and you should not get any amplification in NTC. Use fresh sterile H2O and primer stock. While designing primer for real time PCR if you design the primer from exon exon boundary this avoid primer dimer possibility.
Dear Mr. Mitic,
I will add up that, cDNA concentration also matters. You can use, 25ng, 50ng, 75ng and 100ng cDNA along with the minimal primer concentration you have chosen. Look into where you get the best result. However, you should take care that the Ct value of the particular target gene should not exceed 30.
Primers designed with Primer3 software generally do not result in such problems.
- Badges
- Science topic