Dear colleagues,
My colleague and I cloned a gene from sword bean which is mainly expressed in flower. After I did blast using the protein's amino acid sequence, I found there are just 250 homologues in the database (Uniprot), and only exist in angiosperms including the basal species Amborella trichopoda.
Then, I used the amino acids sequence of these proteins built the
phylogeny tree as attached, and placed Amborella trichopoda at root.The tree (NJ) looks a little strange, the monocots mixed with dicots. In fact, when using NA sequences to generate the tree, the tree shapes are similar.
My questions are :
1. Because no homologues could be found in other than angiosperms.
Can I say this protein appear very later along with evolution of angiosperm?
2. Can I say this protein evolves slowly or conservative, the 250 proteins from angiosperms range from 260-300 AAs and few subtypes of this protein had been reported ?
3. Convergent evolution? Monocots and dicots mixed in the tree.
regards
Zha
Zha,
It is hard to judge unknown gene evolution, but using common cense, I would say/ask:
1. The fact that no homologues have been reported in other plants than angiosperms does not mean: 1) that the protein/gene is absent in other plants - it has not been reported (but still, can be with low similarity) so far in the studied plants out of angiosperms lineage. 2) It cannot be said that this protein appear very late along with evolution of angiosperm - it must be present in the last common ancestor of angiosperms, and it is very old event, and it could be present in other plants of that age.
2. Is the protein-coding gene present in a single/few copy and has no paralogs? Angiosperms have origin about 247 million years ago - plenty of time for evolution of many genes. Your protein must be compared to other to make conclusions about evolution rate.
3. 'Monocots and dicots mixed in the tree' - again the question about the gene copy number. If there are some paralogs - it is normal.
Zha,
It is hard to judge unknown gene evolution, but using common cense, I would say/ask:
1. The fact that no homologues have been reported in other plants than angiosperms does not mean: 1) that the protein/gene is absent in other plants - it has not been reported (but still, can be with low similarity) so far in the studied plants out of angiosperms lineage. 2) It cannot be said that this protein appear very late along with evolution of angiosperm - it must be present in the last common ancestor of angiosperms, and it is very old event, and it could be present in other plants of that age.
2. Is the protein-coding gene present in a single/few copy and has no paralogs? Angiosperms have origin about 247 million years ago - plenty of time for evolution of many genes. Your protein must be compared to other to make conclusions about evolution rate.
3. 'Monocots and dicots mixed in the tree' - again the question about the gene copy number. If there are some paralogs - it is normal.
Hello,
And thank you Alex for your answer.
The protein I am working on is a Class III chitinase. I identified it in floral nectar and I know it is also expressed in leaves. I could not find its homologue in other than angiosperms by blast in Genbank or Uniprot. Because so many plant species’ whole genomes have been sequenced, including gymnosperm, ferns, moss, and algae. If the gene also existed in these taxa, it should be retrieved by Blast. I did find some genes looks a little like this gene in microbes but with very low score.
By the way, we know that only angiosperms have floral nectar and I isolated the protein in it. Gymnosperms have so called “pollination drop”. I am not clear about the difference between pollination drops and nectar in evolutionary sense. There is the reason why I think this protein evolved with the angiosperm separation from lower species.
About its gene copy number，in soybean, there are about 10 homologues (each only has one copy) located in different chromosomes (http://plantgdb.org/GmGDB/cgi-bin/blastGDB.pl).
I am not an experienced phylogeny man. I hope anyone can help me interprete the tree or point out the mistake I made.
I will be more than happy to provide the sequences (NA or AA) I used for the tree construction. If you are interested, please inform me.
Below is the Class III gene from soybean.
Sorry for my language.
Best wishes
Zha
>Glycine max KRH26171
ATGGCATCCCTCAAACAAGTTTCACCCCTATTATTACTCTTCCCTCTATTGCTCATTTCC
CTCTTCAAGTCCTCCCACGCTGCAGGAATTGCCATCTATTGGGGTCAAAACGGAAACGAA
GGCTCCTTGGCAGACGCATGCAACACTGGCAACTACCAATTTGTGAACATAGCATTCTTG
TCCACATTTGGCAATGGCCAAACCCCCCAACTAAACCTCGCTGGCCACTGTGAACCCAGC
ACCAACGGCTGCACCAAATTCAGCGACGAAATCAAGGCGTGCCAGGGCAAAGGCATCAAA
GTGCTACTCTCCCTCGGAGGAGCCAGTGGGAGCTACTCCCTCGGCTCAGCCGAGGAAGCA
ACACAGCTTGCAACCTTTCTTTGGAACAACTTCCTCGGAGGACAGTCGAGTTCCCGCCCA
TTGGGCGATGCTGTCCTCGATGGCATAGACTTTGACATTGAGGCCGGTGGCGGCAACCAT
TGGGATGAACTTGCAAGGGCCCTCAATGGGTTCAGCTCACAGAAGAAGGTGTACTTGGCT
GCAGCCCCACAGTGTCCAATCCCTGATGCTCACTTGGACTCAGCCATCAAAACTGGCCTC
TTTGACTATGTGTGGGTTCAGTTCTACAACAACCCTCCATGCCAGTACTCTAGTGGCAGC
ACCAACAATCTCATCAATTCTTGGAACCAATGGACCTCAAGCCAGGCCAAACAAGTGTTC
TTGGGACTGCCAGCTTCTACTGCAGCTGCTGGTAGTGGGTTTGTTCCTGCTGATGTGTTG
ACCTCCCAGGTTCTTCCTGCTATCAAGGGTTCTGCCAAGTATGGTGGAGTCATGCTTTGG
GACAGATTCAATGATGGTCAAAATAAATACAGTGATGCTATTAAGGGTAGTGTTTAA
Zha,
for your first question:
The soybean gene is coding a protein with homologs present in Marchantia polymorpha subsp. polymorpha (hypothetical protein AXG93_2752s1460 Length: 283 score 1e-73() Identities 137/265(52%) Positives176/265(66%) and in Selaginella moellendorffii hypothetical protein SELMODRAFT_232562 |Length: 296 score 4e-97() identity 160/256(63%)
similarity 198/256(77%) Both are primitive land plants.
For your second question:
acidic endochitinase-like [Phoenix dactylifera - monocot!] ref|XP_008809712.1| has max similarity to the soybean protein with score 2e-130 and identity 192/256(75%) and similarity 217/256(84%). But another protein from this plant with Sequence ID: ref|XP_008791482.1| has score 1e-110 and identity 173/258(67%), similarity 208/258(80%).
at the same time Glycine max has paralog - hypothetical protein GLYMA_15G015100 with score 2e-88, identity 153/263(58%)
and similarity 187/263(71%) - far below "homologs" from monocots.
I guess that this protein is not suitable for taxonomic conclusions because 1) it has many paralogs; 2) it looks like it has significant selection pressure. But, it can be good for plant physiology/pathology study - I guess, it may be associated with some useful traits.
Good luck
Alex
Have you tried Maximum Likelihood or Bayesian methods? It is pretty common that NJ trees, which reflect sequence similarities, does not agree with actual reconstruction of phylogenetic trees. Also I would check the alignment.
Just want to mention some technical issues. It could well be the the homolog issue that others have mentioned, or simply that this gene has deep divergence. Gene trees don't necessarily reflect species tree, especially
Chitinases in plants are not suitable for species-level phylogenies... there are many prologues in many species. Partly this is because several of the chitinases are defence genes (protect against insect herbivory). As a result they can undergo considerable selective pressure depending on which insects affect the plants you are studying. These are not single/low copy number genes. However many flowering control genes have low/single copy number.
- Badges
- Science method
- Similar topics
- Biological Science
- Evolutionary Biology
- Phylogenetics
- Phylogenetic Analysis