you could use pmirGlo construct from promega which has dual  luciferases(one as reporter of miRNA activity while other as control for transfection efficiency)and do transient transfection in cell lines along with miRNAs from lifetechnologies

That is a tricky project since you want to focus on miR-25-3p, which is something of a passenger strand microRNA while miR-25-5p is the dominant microRNA produced from the miR-25 precursor (according to miRBase (http://mirbase.org/cgi-bin/get_read.pl?acc=MI0000082). Cloning the precursor therefore may not give you what you want. You most likely will get mainly miR-25-5p expressed. I would move away completely from the cloning strategy and go with a mimic. They are small, basically siRNA type of reagents, that should be easy to get into the cells. For example, you can get a mimic specifically for miR-25-3p from Qiagen (Syn-hsa-miR-25-3p miScript miRNA Mimic hsa-miR-25-3p MIMAT0000081: 5'CAUUGCACUUGUCUCGGUCUG) or many other companies. Cloning a construct that specifically expresses this microRNA could be more complicated and may not work well using a RNA polymerase II driven promoter used in pcDNA3.1.

As Toyanji mentioned, for the reporter, I would go with pmiRGlo. It is very convenient and all is on one plasmid.

If you still prefer to go with a plasmid for expressing miR-25-3p, then you should go with something like an RNA poly III based system such as psiRNA or similar (http://www.invivogen.com/psirna-system). An overview is given in Ma et al. (Molecular Therapy Nucleic Acids (2014) 3, e161; doi:10.1038/mtna.2014.12. Pol III Promoters to Express Small RNAs: Delineation of Transcription Initiation).

Thank you for your replies. I'm having the 3'UTR of my gene cloned into pmiRGLO and I'll use mimics instead of cloning. I'm new to microRNA research, so I wasn't aware that mimics were an option.