Hi everyone!
I designed primers for PCR and DNA sequencing for JAM2 gene, using these tolls: Primer3, UCSC In-Silico PCR and Primer-BLAST.
Everything seemed to be ok, then I ordered the primers.
But when I checked my primers with normal PCR, most of them didn't work (I put positive control).
I performed a gradient PCR to optimize the annealing temperature, but in vain.
This is an exemple of the primers:
JAM2 _Ex2_Fw - GACTATTGCATCCCATTCAG
JAM2_Ex2_Rv - TTCTTTGCACATCCGGTCT
Any suggestion?
Please add more info like the rest of your PCR parameters and what kind of polymerase you are using and if you are using any additives and describe how you are preparing your PCR rxn.
The polymerase used is the GoTaq Green Master Mix (Promega). The thermo protocol is:
95ºC - 2'
95ºC - 1'
30 cycles TM: 1'
72ºC: 5'
4ºC: soak
I took a look at your primers and they seems fine to me. I personally had multiple problems of this sort when using the basic taq pol (I know it is more preferable to use due to cost), however, all of these problems went away when I used a polymerase with more robust amplification. I suggest you use Phusion Hot Start II DNA Polymerase and use an anneal temp of 53 for your rxn. You can always try to adjust multiple parameters to get it to work with the GoTaq Green Master Mix, however, the time you will spend adjusting will outweigh the cost of a new pol Hope you find this helpful.
One other thing could you tell me what is your input sample is it cDNA or genomic DNA? and what where the primers that gave amplification for the positive control?
Also one other the protocol that you wrote does not have an extension step that is repeated 30 it only has a final extension of 5 minutes ( is this just a typo because otherwise this could explain your entire problem)
Hey Hanna Alalam , thank you!
At this moment, we may not have conditions to order a new Taq. However, right now I'm trying a new PCR with DMSO.
My input is genomic DNA (at 30 ng/uL) and the positive control is the following:
PDGFB_Ex2_Fw - gaggcctttgtgctcctgat
PDGFB_Ex2_Rv - caagtcccaggtaccaaccc
And the protocol that I wrote is really a typo.
This is the correct protocol:
95ºC - 2'
30cycles: 95ºC - 1'
TM: 1'
72ºC: 1'
72ºC: 5'
4ºC: soak
hmm your amplicon GC content is low (38%) and your primers are not particularly GC rich but you can try the DMSO anyways just remember that it lowers the tm of the primers. I suggest you can try the following:
1- Since you are trying DMSO try betaine as well if the DMSO fails.
2- Since your positive control amplified it indicated that there is no PCR inhibitors in your sample so maybe you can try increasing your input DNA.
3-Since all the primers are not working. It might be an error in the synthesis and you might need to re-order the primers.
Best of luck and please let me know what works!
Hanna
I had the same problem with 4 DNA primers last year. Even if they seemed fine, no band was visible in conventional PCR. To solve the problem, I added DMSO in my PCR mix and it worked. Good luck in yours investigations
- Badges
- Science method