I need to determine if my H226 cell line has wildtype or mutant p53. I extracted RNA, performed reverse transcription PCR and sent in 1 ug for sequencing to Retrogen . My sequencing failed and Im not sure if I did something wrong using the cDNA or if maybe my primers were wrong. Below I list my primers. If anyone has insight it would be much appreciated!
Primers used:
Exon 9
F: CCGGCGCACAGAGGAAGAG
R: TCGAAGCGCTCACGCCCACGG
Exon 5
F1: CCTACCAGGGCAGCTACGG
F2: CTCCCCTGCCCTCAACAAG
R: GATGCTGAGGAGGGGCCAGAC
Hi
we recently wrote some recommendations for the analysis of TP53 mutation in tumor or cell lines
http://onlinelibrary.wiley.com/doi/10.1002/humu.22561/abstract
it is an open access
although cDNA is convenient, it can lead to false results
i) splice mutation can be mistaken for deletions
ii) Nonsense-mediated mRNA decay can lead to a degradation of RNA (for frameshift or non sense mutation)
even if it is a little more complicated, genomic DNA is still a gold standard as you will not miss any mutations
last point
I do not know any cell line with the name H226 but I do know NCI-H226
Unfortunately, the TP53 status in this cell line is controversial as some publications claims that it is wt where as another one found a mutation at position 158 in exon 5
info here
http://onlinelibrary.wiley.com/doi/10.1002/humu.22556/abstract
contact me if more info are needed
best
T
RNA is very unstable and easy to degrade so extraction should be very careful and use ice on every step. what about the RNA concentration? Did you find any degradation? How was your PCR amplification? The band was clear and brightor with with non specific and dimer??
Hi Rachel,
the principle should work. What do you mean with "the sequencing failed"? Did you get no sequence at all or not p53 or a"difficult to read sequence"?
I see some problems for exon 9 because several transcript variants of p53 contain an alternative exon 9a. So if your cell line expresses maybe several variants you will not get a clean sequence.
Another possibility may be that your cell line expresses an truncated p53 only.
Did you see a clean PCR product in the agarose gel? Have you used one of the PCR primers for sequencing or an internal one?
I agree with Artur. Try using Genomic DNA first but I would definitely prepare nice RNA to obtain cDNA for sequencing.
Make sure your primers sequences are correct and beware of point mutations.
Hi
cDNA is much better for sequencing P53 or general than DNA and can bring you interesting results. See publication below with conditions and primer sequence.
Good luck
Article cDNA sequencing improves the detection of P53 missense mutat...
Article Elimination of wild-type P53 mRNA in glioblastomas showing h...
In addition I have seen already several groups using this method for sequencing it really works. Any questions please contact.
Basic sequencing protocols usually work well with cDNA. I have one important question regarding the sequencing process you use. Where do you send your samples for sequencing?
Well did have our own automatic seqencer, however it doesn't matter sequencing process and results are the same like on DNA template.
I would really try using high quality cDNA and make sure you have a nice control.
Hi,
I think both methods have pros/cons as already mentioned from all of you. One not mentioned advantage of using cDNA is the ability to sequence genes with many exons with fewer runs i.e. you can sequence the complete p53-ORF with two runs on the c-DNA level whereas you need more (8-9) runs on the DNA level. Of course you only get information from the coding sequence (and maybe splice site mutations) from the cDNA. For intronic mutations or mutations of regulatory regions you have to use DNA.
Following the good point from Norman Hafner, using cDNA also allows you checking P53 target or downstream genes by qPCR.
As you said, you did one-step RT-PCR and sent the product to sequencing company, right? My suggestion is to try two-step: 1) using oligoT primer for cDNA synthesis 2) using cDNA as a template to perform conventional PCR. Then you can clone the PCR product for better sequencing
Rachel please remember that P53 is commonly mutated in hot spot places (ex5-8 or 9) and as our college mentioned below (and described in article) we can sequence several exons in one reaction so it's time and money saving. In addition as also mention below we can use cDNA for Real-Time PCR, however I cannot disagree that reverse transcriptase is not a proofreading enzyme but usually our results were better that on DNA template and the noise level was lower I will try to find article explaining this phenomenon.
I totally agree with Fang Liu about the two step RT-PCR, in this manner you could be sure to analyze a more reliable cDNA.
You can use cDNA but you have to be careful because intronic mutations will be missed.
Hi
we recently wrote some recommendations for the analysis of TP53 mutation in tumor or cell lines
http://onlinelibrary.wiley.com/doi/10.1002/humu.22561/abstract
it is an open access
although cDNA is convenient, it can lead to false results
i) splice mutation can be mistaken for deletions
ii) Nonsense-mediated mRNA decay can lead to a degradation of RNA (for frameshift or non sense mutation)
even if it is a little more complicated, genomic DNA is still a gold standard as you will not miss any mutations
last point
I do not know any cell line with the name H226 but I do know NCI-H226
Unfortunately, the TP53 status in this cell line is controversial as some publications claims that it is wt where as another one found a mutation at position 158 in exon 5
info here
http://onlinelibrary.wiley.com/doi/10.1002/humu.22556/abstract
contact me if more info are needed
best
T
Thierry has correctly pointed out problems in cDNA analysis. DNA sequencing is standard way to identify mutations within genes.
- Badges
- Science method