Hello everyone,
I am performing TA cloning (blunt end) for my gene of interest and while screening for the insertions, I always find my gene is inserted in a forward direction. Whereas by probability I should get at least some clones in reverse direction. Is there any reason I almost always get my genes inserted in forward direction? (8 out of 8 clones had forward insertion)
Any lead is appreciated
Hi,
Actually, it’s based on your chance and 8 colonies has been not enough to get both directions. You have to pick up more colonies, I usually perform around 20 miniprep and then I usually have both directions.
As mentioned above, it's random chance. You can use PCR to directionally screen your clones (1 primer in pTOPO and 1 primer in your insert). Either direction of clone works fine for future use.
I think that everything should have a reason.
I guess the structure of your vector and the insert fits well with the forward order.
The forward insert might be thermostable.
Could you post the sequence and might someone could figure it out?
This is a classic example of a problem that you do not need to solve. You won't get a thesis chapter out of wondering why you got 8/8 colonies with the same direction of insert.
Your cloning was successful! Choose a colony for your next step and call it done.
Thanks everyone for the insights. Of course, this is not something worth investigating, I was just curious.
Junjie Shao Here is the sequence 5'..>3'
The CDS of the insert gene can be found here as well-
https://www.arabidopsis.org/servlets/TairObject?type=sequence&id=12541
I am cloning it into pJET1.2 vector
ATGATGATGATGATTCAGAGAAGAGGAGGTGAGAGACAAGACTCGTCGGCGGCGGCGTACAACGTTGTCCATAAGTTGCCTCACGGAGACAGTCCTTATGTCCGAGCGAAGCATGTTCAGTTGGTGGAGAAAGATGCAGAAGCAGCGATAGAGTTGTTTTGGATAGCGATTAAAGCGAGAGATAGAGTTGATAGTGCTCTTAAAGACATGGCCTTGTTAATGAAACAACAGAACAGAGCTGAAGAAGCCATTGACGCTATTCAATCCTTTAGAGATCTTTGTTCAAGACAAGCTCAAGAGTCATTAGACAATGTCCTCATCGATCTATATAAGAAATGTGGGAGAATAGAAGAGCAAGTTGAGTTATTGAAGCAAAAGCTTTGGATGATATATCAAGGAGAAGCATTCAATGGCAAACCAACAAAGACTGCGAGATCTCATGGCAAGAAGTTTCAGGTCACCGTCGAGAAGGAAACCTCTAGGATCTTGGGGAACTTGGGATGGGCTTATATGCAACTAATGGACTATACAGCAGCTGAAGCTGTGTATCGGAAAGCTCAATTGATAGAGCCAGATGCAAACAAGGCTTGCAATTTATGCACATGTCTCATCAAGCAAGGGAAGCACGATGAGGCGAGGTCGATTCTCTTTCGTGATGTACTAATGGAGAACAAAGAAGGGTCTGGTGATCCGAGGTTGATGGCTCGGGTTCAAGAGCTATTGAGTGAGCTAAAGCCACAGGAAGAAGAAGCAGCGGCTTCTGTGTCTGTGGAATGTGAAGTTGGTATAGATGAGATAGCGGTTGTCGAAGGACTTGATGAGTTTGTGAAGGAATGGAGGAGGCCTTATAGGACAAGAAGACTTCCGATTTTCGAAGAGATCTTACCACTGAGAGATCAATTGGCTTGTTGA
- Badges
- Science method