Junjie Shao

3 Questions 284 Answers 0 Followers

Questions related from Junjie Shao

Replace sp6 by t7, significant lower EGFP expression in 293T cells, why?

Dear all: I replace the sp6 promoter sequence (ATTTAGGTGACACTATAG) by T7 (TAATACGACTCACTATAGGG), after I transfected IVT mRNA into 293T cells, very fewer EGFP positive cells in T7 IVT mRNA...

05 August 2021 6,947 2 View

Is there any protein tags (myc, flag, v5, ha, etc.) works as an adjuvant to enhance the protein based vaccine immunity?

Plan to add a tag with the GOI for the protein-based vaccine. Are there any tags or certain short AAs that can activate the innate immune response?

02 June 2021 5,157 2 View

Is there a replication deficient or single cycle SARS-CoV-2 available for vaccine?

It should be good to mimic the SARS-CoV-2 infection to induce the immune response without severe symptoms.

01 January 1970 2,125 1 View