3 Questions 296 Answers 0 Followers
Questions related from Junjie Shao
Dear all: I replace the sp6 promoter sequence (ATTTAGGTGACACTATAG) by T7 (TAATACGACTCACTATAGGG), after I transfected IVT mRNA into 293T cells, very fewer EGFP positive cells in T7 IVT mRNA...
05 August 2021 7,061 2 View
Plan to add a tag with the GOI for the protein-based vaccine. Are there any tags or certain short AAs that can activate the innate immune response?
02 June 2021 5,368 2 View
It should be good to mimic the SARS-CoV-2 infection to induce the immune response without severe symptoms.
01 January 1970 2,248 1 View