Should I decrease IC50 concentration of the drugs for clonogenic assay for 1000 cell/well?

30 April 2025 0 5K Report

I'm performing clonogenic assay however something is so confused that I'm determining the IC50 of the drug in 96 well plate for 5000 cell/well. Plate 150.000 cell/well for RNA isolation or obtaining pellets with the same IC50 concentrations. However if I plated 1000 cells/well for clonogenic assay and apply IC50 concentrations, most of the cells can die. Do you think that should I use IC30, IC50 and IC70 ceoncentrations together, or just IC50 is enough?

More Burcu Cerci Alkac's questions See All

While doing acridine orange ethidium bromide staining for pancreatic cancer cells, is using fixative like %4 paraformaldehyde is valid?

I'm using panc02 cells, mouse pancreatic cancer cell line.Beforehand, I had some issues without doing any fixation, so now I’m trying with fixed cells.

08 August 2023 9,572 1 View

What could be the reason for water trace between the membrane and PEN slides during laser capture?

I am working with PEN membrane slides used in laser capture microdissection. When I try to cut the cells on the membrane, too many bubbles are seen. I made a tiny hole on the edge of the membrane...

31 May 2023 9,249 3 View

What should be the minimum variable inter-trial interval (ITI) durations in event-related fMRI?

In our study, 3 different conditions and control tasks of each conditions will be evaluated. Therefore, the duration of the experiment may slightly exceed the time required for a suitable fMRI...

24 October 2021 4,309 3 View

Use of the medium in the formation of a hydrogen peroxide-induced senescence model in human fibroblast cells?

Which medium should I use for this experiment? it should contain no phenol red.

21 October 2021 5,545 3 View

How to design a primer for identification?

Hello! I need to identify some microorganisms we isolate from nature. The company we have an agreement says that I need to design a primer as fw primer: 5′ ACACTCTTTCCCTACACGACGCTCTTCCGATCT –...

21 June 2021 8,395 2 View

How can I handle my problem in conversion of OpenFOAM wall shear stress data to Fluent (foamToFluent)?

I have a problem regarding the WSS conversion from OpenFOAM to Fluent. Actually, I can obtain WSS results in OpenFOAM but when I convert the results to Fluent, then WSS values are seen to be zero,...

05 May 2021 3,685 3 View

How can i remove the error bar from the legend?

xdata1=tempmeasS2.Timesec; ydata1=tempmeasS2.UCNP; plot (xdata1,ydata1) err2 = tempmeasS2.UCNP1; e2=errorbar(xdata1,ydata1,err2, 'b-', 'lineWidth', 1, 'HandleVisibility', 'on') legend ('1...

13 January 2021 3,335 3 View

How to prepare 0.03M phosphate buffer pH:4.0?

I want to prepare mobile phase has to be adjusted to pH 4 with o.03M phosphate buffer Can anyone help me to prepare phosphate buffer solution of 0,03M using pH of 4 ? waiting for your favorable...

18 November 2020 344 3 View

How can i reduce my particle size for SLN (my lipid is cethylstearyl alcohol)?

Hello I want to ask about particle size reducing, İ am working on SLN , while i prepare SLN uses "hot homogenization and hot prob sonication technique" but my particle size does not go below 200...

18 November 2020 6,573 0 View

How to prepare 0.035M phosphate buffer pH:4.5?

I want to prepare mobile phase has to be adjusted to pH 4.5 with o.035M phosphate buffer Can anyone help me to prepare phosphate buffer solution of 0,035M using pH of 4.5 ? waiting for your...

18 November 2020 3,529 1 View

Is changing the medium during the experiment overestimate the results?

I am experimenting with cancer and non-cancer cells in a 12-well plate for 4 days with a seeding density 1*10^4/well, however, I noticed that the control group growth rate slows down on D3. Should...

07 August 2024 2,283 2 View

How can I calculate IC50 in DPPH test by using graph pad prism software?

How can I calculate IC50 in the DPPH test using graph pad prism software? or suggest a manual method and other software to calculate the IC50 value.

06 August 2024 8,848 3 View

Which solvent is better to dissolve with secondary metabolites extracted from fungi?

I work on MCF7 cell cell for anticaner purpose and I wa to do drug preperation the drug ( secondary metabolites extracted from Aspergillus) My question which solvent is better with these secodary...

03 August 2024 4,725 2 View

Can i quantify a nanoparticle encapsulated in cell culture medium by hplc?

Hello, if you made a transwell assay where you incubate the cells with a nanoparticle-encapsulated drug and considering that in the oposite compartment you'll have both the free and encapsulte...

03 August 2024 2,730 1 View

How to maintain the drug concentration in cell culture study for long term?

I am working in the filed of long acting drugs with Nano formulation. I want to study the efficacy of my formulation in 2D cell cultures while this required media change on every two days. In such...

24 July 2024 8,696 0 View

How can I determine if a drug binds to a ribosome using a Cryo-EM map?

Hello, I am searching for the binding position of a drug in a ribosome, based on previous work indicating it binds there. The resolution of the ribosome-drug Cryo-EM map is around 2.5 Å. I've been...

19 July 2024 2,155 0 View

How to calculate percentage cumulative drug release?

How to calculate percentage cumulative drug release when, Total volume of dissolution media = 250ml Added formulation was equivalent to 10mg of drug Sample withdrawn = 1ml each time Sink condition...

15 July 2024 4,192 1 View

MTT assay - 6 well plate?

Hi, In the 6 well plate, when I am seeding the cells. Do I add 1ml of complete media to one of the wells for the control at this stage or do I wait unit I am treating the plates to do that? Also...

13 July 2024 9,783 1 View

How to convince decision makers to adjust the legislation to allow opening of drug consumption rooms?

In my country, there is a lot of public outcry in relation to the presence of drug injection and related behaviors in public. Hence at least the bigger cities would probably benefit from the...

08 July 2024 8,903 1 View

Is the use of microcrystalline cellulose MCC 102 in direct compression technology justified, given the low flowability of this excipient?

Hello everyone reading this topic! It is well known that microcrystalline cellulose 102 is recommended for use in direct compression technology, however, like other grades, it has poor flowability...

08 July 2024 2,807 0 View