I am trying to find a good qRT-PCR primer set for a gene that has low expression in our cell lines. As you see in the attachment I have a very sharp one peak when I used cDNA from overexpression samples I got one sharp peak for different primer pairs but when I use cDNA of my parental cells melting curve doesn't look good so that I could trust it is working. Yes it is low expressed in our cell line but shouldn't It give me a high CT but still a good melting curve. What could be the problem ? How can I fix the problem ? Should I just design new primers? Thanks...
Do you try to increase the concentration of your cDNA? Do you try a different Tm with the cDNA from your patients?
Another thing, in your patents when you tested the primer 2 set, the first peak is a NTC?
I am using 1 µg RNA for 20 µl cDNA synthesis and using 2 µl of the cDNA for qRT-PCR. I supposed it is already a good concentration. Should I increase it ?
There is no NTC control the peaks are for technical replicas of the same sample (in triplicate). Thanks...
- An issue with signal to noise
- I can only suggest dropping the annealing_ extension temp by 1-2C. Is it much below or above 65C?
- What are the Tms of your primers and have you tried using them to amplify the product by standard PCR with a 5C range of annealing temp?
We are always using annealing at 60 C extension at 72 C. Should I decrease them like 58 C and 70 C.
Since I got really different TM results with different calculators better I write the seq frw CCAGTCCTTCCGTTGGTTTG rev AACAAAAGTTTCCACCGAGGAC . No I didn't do 5C range. Should I do it with qRT-PCR or standard PCR because we use Takara Green Premix Ex Taq II for qRT-PCr and Thermo SYBR Green for normal PCR and their ion concentrations etc. maybe different Thanks....
Try in normal PCR a gradient Tm and check which is the best for your samples.
- Badges
- Science method