Please look at the following attached picture and suggest the bacteria in the petriplate?

medium in the plate is Rhizobium medium used for isolation of Rhizobium.

07 August 2018 9,424 9 View

Why when I incubate Pseudomonas in medium with cetrimide for 10 days do I get the following patterns?

31 December 2014 3,308 8 View

How can I resolve a band of more than 23kb size on agarose gel?

I am isolating Plasmid from bacteria which is more than 23kb in size. I am using 0.8% Agarose gel on 100V and lambda DNA as marker. I am always getting band at size of 23 kb. I also used supermix...

07 August 2014 7,936 5 View

How does FAME analysis of bacteria help in deciding the novelty of bacteria?

I did sequencing and identified my bacteria by blast in NCBI. I feel my bacteria is of novel strain. Will FAME analysis prove to be useful in deciding the novelty of my bacteria?

03 April 2014 8,307 3 View

What is the difference between Global Impact Factor and Universal Impact factor? Which one is more effective?

I am confused regarding the impact factor criteria of the journals.

01 February 2014 7,679 5 View

What is the difference between minimum inhibitory concentration (MIC) and maximum tolerable concentration (MTC)?

I have to determine MIC and MTC of heavy metals. What is the method to determine both?

09 October 2013 1,466 7 View

Can anyone please tell me the institution offering SEM service for bacterial sample in India?

I am interested for Electron microscopy for my Bacterial sample. I want information regarding the various institutions in india offering this service at reasonable rate.

05 June 2013 897 25 View

Can anyone help me to identify why did I get color change yellow from green in citrate utilization test?

some bacteria is giving the positive result as expected i.e. blue to green but some is giving color change to yellow from green. I taken care of pH while preparing the media. I am attaching the...

05 June 2013 6,396 9 View

Is primer VIC1 (5'TTCCCTCGCAGAGAAAACATC3') and VIC2 (5'CCTGGTTGATCAGGTCGATCT 3') from algD GDP mannose dehydrogenase gene specific for P. aeruginosa?

This primer gives 520bp amplified product.

04 May 2013 7,499 1 View

I have 1.5kb of PCR amplified products and if I go for partial sequencing up to 1kb only, will that information be useful for bacterial identification?

1.5kb of PCR amplified products of bacterial DNA.

02 March 2013 7,833 13 View

No title

02 March 2021 3,060 3 View

Why are the velocities so high in my Boussinesq approximation Fluent simulation?

Hello, I have a mechanism where air rises due to convective flows. In this simulation, nothing is driving the air except this. I understand that the Boussinesq approximation only works for small...

02 March 2021 4,910 3 View

How to normalise data on OPM package from R Studio ?

Good afternoon, I recently used OmniLog from BIOLOG for my experimentations : I tested the metabolism of different strains on 2 types of plates. I have 16 strains of 3 different groups...

02 March 2021 3,584 1 View

What do you know about biotechnology art?

What do you know about biotechnology art?

02 March 2021 1,653 3 View

Which is the best place in the world for the plant biotechnology research?

I am searching for a good place for the Post Doc,

02 March 2021 4,053 3 View

Can NFL theorem be valid in infinite search space in ML?

NFL theorem is valid for algorithms training in fixed training set. However, the general characteristic of algorithms in expanded or open dataset has not been proved yet. Could you show your...

01 March 2021 1,189 3 View

How to simultaneously perform multiple biochemical assays?

I am a research scholar working on heavy metal stress on plants. I will be doing biochemical characterisation( protein, carbohydrate, proline, antioxidant enzymes and many more assays) at interval...

01 March 2021 6,999 3 View

Is CD44 degraded in lysosome together with hyaluronan after CD44 mediated endocytosis of hyaluronic acid?

Also when RHAMM binds hyaluronic acid, they get internalized, will RHAMM also be degraded? Or both CD44 and RHAMM will be transferred back to the cell membrane? Asking for breast cancer cell line...

01 March 2021 8,169 2 View

Where to find data on trees in tropical agroforestry?

Hi, I'm looking for data (mainly related to management: growth rate, canopy size, soil and climate preferences, etc.) about tropical trees used in tropical agroforestry. Have you ever heard about...

28 February 2021 7,356 8 View

Is there any published or unpublished statistics on dropout rate (Dose1 to Dose-2) for Covid-19 vaccination in India, US, UK or any other country?

Are there any published or unpublished statistics or papers on the dropout rate (Dose1 to Dose-2) for Covid-19 vaccination in India, USA, UK, or any other country where vaccination has started at...

28 February 2021 4,237 1 View