Please somebody send me what are the max. permissible limit of heavy metal in soil in india?

Ali Asger Bhojiya @Ali_Bhojiya

09 September 2015 0 9K Report

i am interested in max. permissible limit of zinc,iron,lead in agricultural soil and mine tailing in india.

Badges
Science topic

Similar topics
Geoscience
Asia
India

More Ali Asger Bhojiya's questions See All

Please look at the following attached picture and suggest the bacteria in the petriplate?

medium in the plate is Rhizobium medium used for isolation of Rhizobium.

07 August 2018 9,491 9 View

Why when I incubate Pseudomonas in medium with cetrimide for 10 days do I get the following patterns?

When I left the Pseudomonas on medium like cetrimide agar, kings medium for more than 10 days. I found root like pattern on plates. Please someone explain the reason for this. Please see the...

31 December 2014 3,382 8 View

How can I resolve a band of more than 23kb size on agarose gel?

I am isolating Plasmid from bacteria which is more than 23kb in size. I am using 0.8% Agarose gel on 100V and lambda DNA as marker. I am always getting band at size of 23 kb. I also used supermix...

07 August 2014 8,011 5 View

How does FAME analysis of bacteria help in deciding the novelty of bacteria?

I did sequencing and identified my bacteria by blast in NCBI. I feel my bacteria is of novel strain. Will FAME analysis prove to be useful in deciding the novelty of my bacteria?

03 April 2014 8,384 3 View

What is the difference between Global Impact Factor and Universal Impact factor? Which one is more effective?

I am confused regarding the impact factor criteria of the journals.

01 February 2014 7,762 5 View

What is the difference between minimum inhibitory concentration (MIC) and maximum tolerable concentration (MTC)?

I have to determine MIC and MTC of heavy metals. What is the method to determine both?

09 October 2013 1,554 7 View

Can anyone please tell me the institution offering SEM service for bacterial sample in India?

I am interested for Electron microscopy for my Bacterial sample. I want information regarding the various institutions in india offering this service at reasonable rate.

05 June 2013 981 25 View

Can anyone help me to identify why did I get color change yellow from green in citrate utilization test?

some bacteria is giving the positive result as expected i.e. blue to green but some is giving color change to yellow from green. I taken care of pH while preparing the media. I am attaching the...

05 June 2013 6,462 9 View

Is primer VIC1 (5'TTCCCTCGCAGAGAAAACATC3') and VIC2 (5'CCTGGTTGATCAGGTCGATCT 3') from algD GDP mannose dehydrogenase gene specific for P. aeruginosa?

This primer gives 520bp amplified product.

04 May 2013 7,567 1 View

I have 1.5kb of PCR amplified products and if I go for partial sequencing up to 1kb only, will that information be useful for bacterial identification?

1.5kb of PCR amplified products of bacterial DNA.

02 March 2013 7,900 13 View

• What the possible Persistent Organic Pollutants and Heavy metals present in fluorspar, sediments, and water bodies around its mining area?

Approximate concentrations are require in compared with the WHO permissible limts

11 August 2024 2,723 1 View

Do you know best mines of western part of Afghanistan?

I want to know more about Mn deposits in west of Afghanistan.

07 August 2024 3,427 1 View

How to prepare the nanoparticle treated fungal sample for Environmental SEM analysis?

A fungal strain was treated with nanoparticles. We want to do an environmental SEM analysis. So could anyone share your views on preparing the sample? Thank you.

07 August 2024 5,307 1 View

What precautions should be taken while handling S. aureus enterotoxin Type B in the lab?

I would like to understand potential safety concerns while handling SEB in the lab. Especially while working in animal house facility. Would like to know precautions for handling. Sigma MSDS...

07 August 2024 6,034 3 View

How do soil microflora interact with plant roots and influence plant nutrition, health, and productivity?

06 August 2024 9,618 3 View

How can I find access to heavy metal reference doses from the EPA and WHO websites?

Reference dose and Maximum acceptable concentrations HMs

03 August 2024 8,230 4 View

Should I remove an item from a scale to raise Cronbach's alpha and McDonald's omega or is it better to leave it if they are both over .7 already?

Hello! I have this scale which had 10 items initially. I had to remove items 8 and 10 because they correlated negatively with the scale, and then I removed item 9 because Cronbach's alpha and...

01 August 2024 4,606 7 View

Why 3 replicates for most biological assays? Is it enough to examine the data fits normal distribution?

Just bounced on me. Before statistically analysing significant difference, shouldn't we see if data fits normal distribution first? Is 3 replicates enough to testify the hypothesis of normal...

31 July 2024 8,141 13 View

Posthoc test lettering in JAMOVI?

Does anyone know of a module for the JAMOVI software that is capable of generating mean separations using the classic letters based on post hoc results (e.g., Tukey test)? If, as I believe, such...

31 July 2024 3,333 4 View

Given the current level of natural phenomena cause by the climate change and environmental pollution, will the AI find the technological solutions?

AI-driven technologies offer previously unheard-of capabilities to process enormous volumes of data, extract insightful knowledge and improve predictive models, according to the UN’s World...

31 July 2024 9,733 3 View