Please look at the following attached picture and suggest the bacteria in the petriplate?

medium in the plate is Rhizobium medium used for isolation of Rhizobium.

07 August 2018 9,424 9 View

Please somebody send me what are the max. permissible limit of heavy metal in soil in india?

08 September 2015 8,915 0 View

Why when I incubate Pseudomonas in medium with cetrimide for 10 days do I get the following patterns?

31 December 2014 3,308 8 View

How can I resolve a band of more than 23kb size on agarose gel?

I am isolating Plasmid from bacteria which is more than 23kb in size. I am using 0.8% Agarose gel on 100V and lambda DNA as marker. I am always getting band at size of 23 kb. I also used supermix...

07 August 2014 7,936 5 View

How does FAME analysis of bacteria help in deciding the novelty of bacteria?

I did sequencing and identified my bacteria by blast in NCBI. I feel my bacteria is of novel strain. Will FAME analysis prove to be useful in deciding the novelty of my bacteria?

03 April 2014 8,307 3 View

What is the difference between Global Impact Factor and Universal Impact factor? Which one is more effective?

I am confused regarding the impact factor criteria of the journals.

01 February 2014 7,679 5 View

What is the difference between minimum inhibitory concentration (MIC) and maximum tolerable concentration (MTC)?

I have to determine MIC and MTC of heavy metals. What is the method to determine both?

09 October 2013 1,466 7 View

Can anyone help me to identify why did I get color change yellow from green in citrate utilization test?

some bacteria is giving the positive result as expected i.e. blue to green but some is giving color change to yellow from green. I taken care of pH while preparing the media. I am attaching the...

05 June 2013 6,396 9 View

Is primer VIC1 (5'TTCCCTCGCAGAGAAAACATC3') and VIC2 (5'CCTGGTTGATCAGGTCGATCT 3') from algD GDP mannose dehydrogenase gene specific for P. aeruginosa?

This primer gives 520bp amplified product.

04 May 2013 7,499 1 View

I have 1.5kb of PCR amplified products and if I go for partial sequencing up to 1kb only, will that information be useful for bacterial identification?

1.5kb of PCR amplified products of bacterial DNA.

02 March 2013 7,833 13 View

How to normalise data on OPM package from R Studio ?

Good afternoon, I recently used OmniLog from BIOLOG for my experimentations : I tested the metabolism of different strains on 2 types of plates. I have 16 strains of 3 different groups...

02 March 2021 3,584 1 View

New Journal, "Integrative Psychological and Behavioral Science" -- do you not know, and have you not seen, this done before?

Question to you and THEM, the New Journal, "Integrative Psychological and Behavioral Science" -- do you not know, and have you not seen, this done before? There appears to be a core problem for...

02 March 2021 3,024 2 View

Does anyone know HRM channel in a 2 plex QIAGEN Rotor- Gene Q qPCR can be used as a separate channel?

I am going to have 3 different probes in my qPCR work that I am going to do. But I realized that the machine we have in the lab is a Rotor-Gene Q 2plex HRM Platform, saying it has green, yellow,...

01 March 2021 8,544 1 View

Could you please recommend some good journal that accept very long revie papers (approximately 6000+ words) in neurosurgery, cancer biology ?

Could you please recommend some good journal that accept very long revie papers (approximately 6000+ words) in neurosurgery, cancer biology ?

01 March 2021 8,087 3 View

Is CD44 degraded in lysosome together with hyaluronan after CD44 mediated endocytosis of hyaluronic acid?

Also when RHAMM binds hyaluronic acid, they get internalized, will RHAMM also be degraded? Or both CD44 and RHAMM will be transferred back to the cell membrane? Asking for breast cancer cell line...

01 March 2021 8,169 2 View

Where to find data on trees in tropical agroforestry?

Hi, I'm looking for data (mainly related to management: growth rate, canopy size, soil and climate preferences, etc.) about tropical trees used in tropical agroforestry. Have you ever heard about...

28 February 2021 7,356 8 View

The Shannon's index is inversely proportional to Simpson's index (1-D)?

I'm having a problem with my bloxplot with Shannon's and Simpson's indexs. The value of Shannon for my Community 1 indicating higher diversity (in relation of the Community 2), but have lower...

26 February 2021 3,033 9 View

Has anyone used the Illumina ITS1 primer sets?

Hi everyone, Illumina provides a list of primers to amplify with high taxonomic coverage the ITS1 region for further fungal sequencing, but I cannot find the exact amount necessary of each...

25 February 2021 6,969 3 View

Unknown debris sheets observed in cell culture flasks?

Hi, We culture neural progenitor cells in T175 culture flasks coated with PLO-Laminin. We have successfully grown these cells with our protocol for months. Recently, we observed large sheets...

25 February 2021 3,443 4 View

Is there any one who can provide a donation of HPV detection and genotyping kits in exchange collaboration fors?

Warm greetings My name is Ayichew S. and I am doing my Ph.D. in Medical Microbiology (on Human papillomavirus). At this stage, I have almost completed a clinical sample Cervical swabs)...

25 February 2021 1,660 3 View