Please look at the following attached picture and suggest the bacteria in the petriplate?

medium in the plate is Rhizobium medium used for isolation of Rhizobium.

07 August 2018 9,424 9 View

Please somebody send me what are the max. permissible limit of heavy metal in soil in india?

08 September 2015 8,915 0 View

Why when I incubate Pseudomonas in medium with cetrimide for 10 days do I get the following patterns?

31 December 2014 3,308 8 View

How can I resolve a band of more than 23kb size on agarose gel?

I am isolating Plasmid from bacteria which is more than 23kb in size. I am using 0.8% Agarose gel on 100V and lambda DNA as marker. I am always getting band at size of 23 kb. I also used supermix...

07 August 2014 7,936 5 View

How does FAME analysis of bacteria help in deciding the novelty of bacteria?

I did sequencing and identified my bacteria by blast in NCBI. I feel my bacteria is of novel strain. Will FAME analysis prove to be useful in deciding the novelty of my bacteria?

03 April 2014 8,307 3 View

What is the difference between minimum inhibitory concentration (MIC) and maximum tolerable concentration (MTC)?

I have to determine MIC and MTC of heavy metals. What is the method to determine both?

09 October 2013 1,466 7 View

Can anyone please tell me the institution offering SEM service for bacterial sample in India?

I am interested for Electron microscopy for my Bacterial sample. I want information regarding the various institutions in india offering this service at reasonable rate.

05 June 2013 897 25 View

Can anyone help me to identify why did I get color change yellow from green in citrate utilization test?

some bacteria is giving the positive result as expected i.e. blue to green but some is giving color change to yellow from green. I taken care of pH while preparing the media. I am attaching the...

05 June 2013 6,396 9 View

Is primer VIC1 (5'TTCCCTCGCAGAGAAAACATC3') and VIC2 (5'CCTGGTTGATCAGGTCGATCT 3') from algD GDP mannose dehydrogenase gene specific for P. aeruginosa?

This primer gives 520bp amplified product.

04 May 2013 7,499 1 View

I have 1.5kb of PCR amplified products and if I go for partial sequencing up to 1kb only, will that information be useful for bacterial identification?

1.5kb of PCR amplified products of bacterial DNA.

02 March 2013 7,833 13 View

New Journal, "Integrative Psychological and Behavioral Science" -- do you not know, and have you not seen, this done before?

Question to you and THEM, the New Journal, "Integrative Psychological and Behavioral Science" -- do you not know, and have you not seen, this done before? There appears to be a core problem for...

02 March 2021 3,024 2 View

No title

01 March 2021 3,905 5 View

Could you please recommend some good journal that accept very long revie papers (approximately 6000+ words) in neurosurgery, cancer biology ?

Could you please recommend some good journal that accept very long revie papers (approximately 6000+ words) in neurosurgery, cancer biology ?

01 March 2021 8,087 3 View

How to highlight novelty in your research paper?

I have come up with a method and had written a paper on it. Paper got rejected by a journal stating that there is no theoretical novelty. I am kind of confused on why the novelty that I am able to...

28 February 2021 2,393 8 View

Can I follow Researchers from Teaching and testing areas?

I want Researchers from Educational Measurement and Evaluation, relating to teaching, learning , academic performance and test validation

18 February 2021 4,757 13 View

Which and How to use teaching strategies and procedures to effectively integrate the four skills while teaching English Language Online?

As an inexperienced teacher in the field of online teaching, I have the fear of unconsciously ignoring one of the skills while focusing on not ignoring the other! Therefore, I wish to make use of...

09 February 2021 5,101 4 View

Best analysis method to use for my variables?

I need to conduct an analysis and wanted to check if my idea for analysis sounds feasible. I have 3 DVs which are; fear of terrorism, confidence in the police and punitive attitudes towards...

07 February 2021 5,746 10 View

Is receiving Invitation to submit a article from the journal is big deal ???

I have recently received a invitation from the journal "Current Pharmaceutical Bio-technology" to submit a research article. As i didn't received any invitation before. so, is it normal to to...

04 February 2021 4,596 23 View

Which is the appropriate statistic test to examine the relation between students' affective state and academic performance?

Which test should I use to compare students' mood effects on academic performance? I want to compare mood measured on a likert scale (from point 1= very sad to point= 5 very happy) to three...

04 February 2021 1,907 5 View

How to measure the relationship between students' readiness to E-learning and their academic performance?

I'm currently studying the relationship between students' readiness to E-learning and their academic performance. The variables are: Students' readiness: I intend to measure it through...

03 February 2021 9,207 8 View