What is the difference between Global Impact Factor and Universal Impact factor? Which one is more effective?

More Ali Asger Bhojiya's questions See All

Please look at the following attached picture and suggest the bacteria in the petriplate?

medium in the plate is Rhizobium medium used for isolation of Rhizobium.

07 August 2018 9,491 9 View

Please somebody send me what are the max. permissible limit of heavy metal in soil in india?

i am interested in max. permissible limit of zinc,iron,lead in agricultural soil and mine tailing in india.

08 September 2015 9,006 0 View

Why when I incubate Pseudomonas in medium with cetrimide for 10 days do I get the following patterns?

When I left the Pseudomonas on medium like cetrimide agar, kings medium for more than 10 days. I found root like pattern on plates. Please someone explain the reason for this. Please see the...

31 December 2014 3,382 8 View

How can I resolve a band of more than 23kb size on agarose gel?

I am isolating Plasmid from bacteria which is more than 23kb in size. I am using 0.8% Agarose gel on 100V and lambda DNA as marker. I am always getting band at size of 23 kb. I also used supermix...

07 August 2014 8,011 5 View

How does FAME analysis of bacteria help in deciding the novelty of bacteria?

I did sequencing and identified my bacteria by blast in NCBI. I feel my bacteria is of novel strain. Will FAME analysis prove to be useful in deciding the novelty of my bacteria?

03 April 2014 8,384 3 View

What is the difference between minimum inhibitory concentration (MIC) and maximum tolerable concentration (MTC)?

I have to determine MIC and MTC of heavy metals. What is the method to determine both?

09 October 2013 1,554 7 View

Can anyone please tell me the institution offering SEM service for bacterial sample in India?

I am interested for Electron microscopy for my Bacterial sample. I want information regarding the various institutions in india offering this service at reasonable rate.

05 June 2013 981 25 View

Can anyone help me to identify why did I get color change yellow from green in citrate utilization test?

some bacteria is giving the positive result as expected i.e. blue to green but some is giving color change to yellow from green. I taken care of pH while preparing the media. I am attaching the...

05 June 2013 6,462 9 View

Is primer VIC1 (5'TTCCCTCGCAGAGAAAACATC3') and VIC2 (5'CCTGGTTGATCAGGTCGATCT 3') from algD GDP mannose dehydrogenase gene specific for P. aeruginosa?

This primer gives 520bp amplified product.

04 May 2013 7,567 1 View

I have 1.5kb of PCR amplified products and if I go for partial sequencing up to 1kb only, will that information be useful for bacterial identification?

1.5kb of PCR amplified products of bacterial DNA.

02 March 2013 7,900 13 View

How can we use mobile apps for improving students' academic performance?

Mobile apps can be a powerful tool for enhancing academic performance, how can we use mobile apps for improving academic performance

04 August 2024 9,492 0 View

Unethical or Illegal? Reviewers Requesting Self-Citations in Unrelated Manuscripts?

Dear Friends and Colleagues, I have a question regarding the review process for journal submissions. When we submit an article to a journal, is it illegal for a reviewer to provide authors with a...

09 July 2024 7,557 7 View

Short communication journals for mini review submission?

Is it possible to submit a mini review in short communication. Please suggest some journals accepting mini review as a short communication.

08 July 2024 8,553 1 View

Is there a good "no frills" search tool for highlighted text?

I am looking for a no frills search tool that will find highlighted text in pdf and epub files. I just want something that will just take me to the next highlighted word or phrase in the way a...

07 July 2024 190 5 View

I have several paper plans related to multidisciplinary scope (FREE). Can anyone collaborate with me?

We invite researchers, academics, and practitioners from various fields to join us in a collaborative effort to write multidisciplinary papers. The goal of this initiative is to combine...

01 July 2024 6,083 7 View

Are all indexing bodies for the journal's evaluation similar?

A Guide to Journal Indexing Academic journals undergo evaluation by various indexing bodies to ensure ethical practices and high publishing standards. Three prominent indexes include: · PubMed...

27 June 2024 4,415 0 View

Journal's Impact Factor: Publication or Updated?

There are two scenarios: The Impact Factor at the time an article is published. The Impact Factor after the journal updates its metrics annually based on performance. While being interviewed or...

25 June 2024 7,825 2 View

Is AI better in publishing research works than humans?

I would like to know whether AI tools like ChatGPT can publish high quality research work in reputed scopus indexed (peer-reviewed) journals much better than human's research quality.

24 June 2024 9,109 9 View

How can i make Microsoft Copilot have predictive capabilities ?

I am working on a project to integrate data from Campus Management Systems and Learning Management Systems into a predictive AI model that forecasts students' academic performance. I want to use...

22 June 2024 831 2 View

Can you describe the novel techniques used for the realization of quantum well?

it is an academic writing

21 June 2024 8,384 0 View

Nadine A. Gund

http://globalimpactfactor.com/

http://www.uifactor.org/

Cheer, Nadine

Arun Balasuburamaniam

Which Impact factor is Good. and what is the validity of the journal which has UIF ??

R. Ki

Dear Arun,

You can find your answer at: http://www.scholarsteer.com/

You can find various means to find out a good journal.here are various means to find out a good journal.

Emmanuel Toppo

Check following link http://scholarlyoa.com/2013/08/06/bogus-impact-factor-companies/

A blog can not decide whether any company is fake or not