Ali Asger Bhojiya

12 Questions 11 Answers 0 Followers

Questions related from Ali Asger Bhojiya

Please look at the following attached picture and suggest the bacteria in the petriplate?

medium in the plate is Rhizobium medium used for isolation of Rhizobium.

08 August 2018 9,464 9 View

Please somebody send me what are the max. permissible limit of heavy metal in soil in india?

i am interested in max. permissible limit of zinc,iron,lead in agricultural soil and mine tailing in india.

09 September 2015 8,954 0 View

Why when I incubate Pseudomonas in medium with cetrimide for 10 days do I get the following patterns?

When I left the Pseudomonas on medium like cetrimide agar, kings medium for more than 10 days. I found root like pattern on plates. Please someone explain the reason for this. Please see the...

01 January 2015 3,355 8 View

How can I resolve a band of more than 23kb size on agarose gel?

I am isolating Plasmid from bacteria which is more than 23kb in size. I am using 0.8% Agarose gel on 100V and lambda DNA as marker. I am always getting band at size of 23 kb. I also used supermix...

08 August 2014 7,984 5 View

How does FAME analysis of bacteria help in deciding the novelty of bacteria?

I did sequencing and identified my bacteria by blast in NCBI. I feel my bacteria is of novel strain. Will FAME analysis prove to be useful in deciding the novelty of my bacteria?

04 April 2014 8,353 3 View

What is the difference between Global Impact Factor and Universal Impact factor? Which one is more effective?

I am confused regarding the impact factor criteria of the journals.

02 February 2014 7,731 5 View

What is the difference between minimum inhibitory concentration (MIC) and maximum tolerable concentration (MTC)?

I have to determine MIC and MTC of heavy metals. What is the method to determine both?

10 October 2013 1,518 7 View

Can anyone please tell me the institution offering SEM service for bacterial sample in India?

I am interested for Electron microscopy for my Bacterial sample. I want information regarding the various institutions in india offering this service at reasonable rate.

06 June 2013 947 25 View

Can anyone help me to identify why did I get color change yellow from green in citrate utilization test?

some bacteria is giving the positive result as expected i.e. blue to green but some is giving color change to yellow from green. I taken care of pH while preparing the media. I am attaching the...

06 June 2013 6,435 9 View

Is primer VIC1 (5'TTCCCTCGCAGAGAAAACATC3') and VIC2 (5'CCTGGTTGATCAGGTCGATCT 3') from algD GDP mannose dehydrogenase gene specific for P. aeruginosa?

This primer gives 520bp amplified product.

05 May 2013 7,542 1 View

I have 1.5kb of PCR amplified products and if I go for partial sequencing up to 1kb only, will that information be useful for bacterial identification?

1.5kb of PCR amplified products of bacterial DNA.

03 March 2013 7,871 13 View

Can anyone provide the genus specific primers for common bacteria?

I am studying the diversity of bacteria and biochemical identification is time consuming.

12 December 2012 3,594 0 View