Hello Everyone,
I am wanting to PCR a whole vector (except a region which I am trying to delete). The size of my desired product is around 6kb. My primers are as follows:
1. 5 - TCCAATTTGTTAAAGACAGG
2. 5 - GGTTGTGGCCATATTATCATC
Using phusion polymerase, I have been trying touchdown PCR with a protocol as follows:
30sec - 98
30sec - 65 to 55 (0.5 increments)
10min - 72
--- 20 cycles ---
30sec - 98
30sec - 55
10min - 72
I keep getting terrible smearing and an unclear band. I am running a control which is suppose to amplify 10kb (from the phusion kit made with costume DNA and primers), and it is performing this no problem. Thus, I am not sure what is causing the problem.
Can anyone provide any suggestions on how to get this to work?
Adam
Your extension time is very high that why you keep getting smear. Use 3 to 4 minutes for you template. Also check the quality of your template and try to add of it as little as possible. Also 6kb is not particularily big you might not need a touchdown PCR.
DEar ADam
just 2 comments:
The Tm of your primers are quite low and not so much homogeneus.
For example using http://biotools.nubic.northwestern.edu/OligoCalc.html
1. 5 - TCCAATTTGTTAAAGACAGG --> Tm salt adjusted = 52,3°C
2. 5 - GGTTGTGGCCATATTATCATC --> Tm salt adjusted is 57,5°
Generally is it preferable that both primers are caracherized by a similar Tm (i suggest to re-desing a longer primer 1 to reach a Tm similar to 57,5°C and repeat the PCR.
As addictional comment:
I never used PHfusion and i'm not expert about it. I routimelly performed PCR of whole vectors to perform PIPE cloning and i'm using Kapa Hifi (Roche) and Clone Amp Hifi (Takara) and it works quite well, so in case you cannot optimize your protocoll with pHfusion i suggest to you to test one of this other taqs.
good luck
MAnuele
I would suggest to go higher with the annealing temperature, to reduce the elongation time of the PCR program and to check the concentration/purity of the template
The following adjustments were made:
1. lowering the elongation period to 4min.
2. 0.5ng was DNA template was used.
Now, nothing is showing up. Changing the primer sequence should not be a problem. Yes it is low, but within 5 degrees thus by most standards it should be fine.
There are overhang regions which I did not specify in the original primer sequences. Is it possible to utilize that aspect to increase the annealing temp? For example, to a touchdown PCR, and then amplify at a primer annealing temperature which includes the overhang?
Adam
- Badges
- Science method