Check the MethPrimer software, here's the link

http://www.urogene.org/methprimer/

Yes methyl primer express from applied is good. But you need to modify some parameters as the size of the region to be amplified. For both BSP (sequencing) and MSP, PCR works better with small region (between 150-250bp) as the DNA was highly degraded by bisulfite treatment.

Dear Dave Lee,

My first comment: don't try to analyze a sequence longer than 300 bp (thus, you need two primer pairs to analyze the seq above). Second comment: it will be very difficult to design primers since your seq almost consists of Cs and Gs (it is strongly recommended to check any pimer pair by using your seq as a cloned, non-methylated version. Only in case that you achieve full conversion it makes sense to use you "real sample".

I am almost sure that non of the available software will result in "good primers" with your CG-seq. As you know, bi-seq is strand specific. Thus, the foward primer to analyze the lower strand of your seq should not contain too many Gs. Cs, As and Ts will be fine. For the reverse primer to analyze the lower strand of your seq it is accordingly the opposite. It should contain only a few Cs but a lot of Gs.

Best wishes,

Michael

I just let your sequence run through the MethylPrimee Express without any change and surprisingly I get both BSP and MSP primers. Not too much but it is worth to work with it. Basically Michael W has right, it is very CG rich. I use this program quite oft and I am satisfied with it. However I woud use only short fragments up to 150bp to amplifie. Use more regions on the sequence.

You guys are truly awesome,

Thank you so much for all your inputs.

So sorry that I can't add individual replies, but they are all just so helpful..

I will definitely consider doing analyses in fragments!

Thank you again guys.. really appreciate it

Personally, I used Methyl Primer Express from Applied Biosystems over MethPrimer based on recommendations from other colleagues who noticed having better success with it. However, I do like Methprimer for its quick analysis of your sequence, very informative.

I also agree on the other answers, you probably might want to consider narrowing down your target region or use several overlapping primer pairs. If you can't have a good and specific amplification with one of them, you can also do a nested PCR, it helped me a lot in my case for some of the regions I wanted to look at.

Of note, this fragment of 700+ bp may be too long for your downstream sequencing technology anyway.

Why don't you design your own primers using Ys. You really don't know meth status yet.

I am currently doing smilar research. I have used two software for primer design for metylation studies. Try Kismeth http://katahdin.mssm.edu/kismeth/revpage.pl or also you could use MethPrimer. I could get about 600-900 bp amplicon and well sequenced data.

Hi Dave,

I would recommend Meth Primer (http://www.urogene.org/methprimer/), although I usually want information about a specific CpG residue in which case I will use the bisulphite output from this to design them by eye.

These are the few rules I try to stick to;

Avoid runs of 5 or more of the same nucleotide in your primer.

Try to include a G or C residue in the last 5 bases to utilize the GC Clamp.

I try to keep most of my bisulphite PCR's around 400bp, but I always design two sets of primers and use a nested approach. It works well even if there is no visible product from your first round of PCR.

I then use BiSearch (http://bisearch.enzim.hu/) which will let you perform an in silico bisulphite PCR. Since you are technically only working with three bases, its harder to make the primers specific so it's important to test this. Often with bisearch, I may get a few products of different sizes, however you can judge weather they will interfere with your second round of PCR. I usually get one good band after the second round even if Bisearch has predicted a few different products in the first round.

Your sequence does look incredibly GC rich so perhaps have some DMSO to hand if it doesn't work first time!

Good Luck!

Jayne.

Thank you very much for all the inputs!!!!

This really helps me a lot.

If it is not too much to ask, Could I also ask you guys which PCR parameters you are using for PCR amplification of bisulfite converted DNA?

(e.g. Cycle temp, #, steps, etc)

You guys are so amazing, thank you all

there are a web site Zymo research bisulfite primer seeker.

if your sequence is promoter region,I recommend you that at first you check pron of methylation of your sequence in NCBI-Epigenome and after than use the methprimer - bisulfite sequencing and finally for checking primer stability and et al use Oligo software.

additionally if your sequence fragment supply from cancer tissue or others. I recommend you should cloning to vector because your sequence results will be mix methylation and unmethylatuion products.

For the PCR you have to optimize quite a lot, but there are some quide lines:

1, Use HotStart polymerase, wich can recognize uracil and 5mC (in promoter regions you will have methylated cytosines). Proof reading polymerases does not capable for that.

2, Use touch down PCR to increase the specificity of the amplification

3, The number of necessary cycling depend from the amplification biaz, but usually 35-45 cycles.

4, For bisulfit PCR you have to use more template DNA as for normal genomic PCR

Good luck!

I use Methprimer program work good for me. The other thing is with the PCR amplify small fragments of DNA no more the 200 bp. The bisulfide conversion can break the DNA

We have done both PyroSequencing or sequencing of individual promoters. We do our planning for the latter by converting all C's to T's for each DNA sequence (each strand separately), then design primers using MacVector. We extend the length of potential primers to 35, relax the GC content to 30%, and Tm to 52. For example, you could sequentially use nested primers TGGGGTTAGGGTTTTTTATGTG and CACATCTACACACCTCCATCCTC, followed by GGGTTAGGGTTTTTTATGTGTGTAGTAG and ATCTACACACCTCCATCCTCCCCTTCAC. The primers I listed here may not be optimal, but MacVector suggested a few different overlapping ones that may work. The other strand, which is not complementary to the first strand after bisulfite conversion, would need to be examined separately. Remember as well that methylated C's will not be converted to T, which may be important for primer design. Conditions for PCR are described in our paper Maier et al. Nat Immunol 5:1069-1077 (2004). This method (seems so long ago!) involved cloning and sequencing the individual PCR products, but it should be easy to modify the protocol for NextGen sequencing.

Hi Dave, if you are having problems with your amplification try "Platinum Taq DNA Polymerase High Fidelity". It worked like magic to us after we have tried all sorts of Taqs you can imagine.

Meth primer is good for designing primers but you can design them by yourself too.If you are going to do MSP you can have more flexibility while in sequencing the length of amplified sequence should be less than 400 because the bisulfite treated sequence can not be sequenced very good

the primers in bisulfite treated DNA should containg at least one CpG at their 5' end we have seen good results by them

Use MethPrimer for primer design and use nested PCR for amplification.

the PCR should not be longer then 150 base

 hi friends

I am working on bisulfite sequencing PCR. I can not get good result of PCR. 

i am using touchdown PCR followed by semi nested PCR. but again, my band is too weak. what is your advice?

I have been using MethPrimer and out of 5 primers, I can get consistent amplification with 2 primer sets :(  I found Tm from MethPrimer is generally too low.

I am going to try Zymo bisulfite primer seeker. 

I'm satisfied with primers designed via BiSearch. Considering amplicon length: we described a single multi-purpose PCR-based integrity assay for both native and bisulfite treated DNA (doi: https://doi.org/10.1101/168195). Based on the results of the bisulfite integrity assay you can decide on the amplicon length for bisulfite sequencing of your specific sample (depends on the quality of your native DNA and the way you performed the bisulfite treatment). Works for most investigated mammal species (assay design strategy can be used for other species classes). Don't hesitate to contact me for feedback.

Meth primer

http://www.urogene.org/cgi-bin/methprimer/methprimer.cgi

Methyl Primer Express Software works great for MSP and BSP primer design.

https://www.thermofisher.com/order/catalog/product/4376041

I did PCR amplification of the bisulfited DNA with Hot Start Polymerase. Tip: Extra step of DNA cleaning before the PCR to avoid salt contamination