How are your controls working? You should have some positive controls with your experiments. If your positive controls aren't working, you need to check them and your primers to make sure they match appropriately.

There are a couple of easy things you can try.

- increase the amount of primary PCR product you are adding to the second PCR reaction. When I did nested PCR, I didn't dilute the primary PCR product.

- play with your magnesium, annealing temperature, or try adding something like BSA.

Obviously don't change them all at once, but I like doing gradients to see if that changes my results.

are you using 2 different primer sets with the second nested set located inside the first primer set or just amplifying with the same primers twice?

Do you have a positive control sample that should amplify?

what length is your amplimer.These times are very long.If the amplimer is 2-500 bases the 10 seconds annealing and 20 seconds extension is plenty. Can we see a gel picture please....with 70 cycles you may be getting too much amplification and a smear of pcr product instead of just a band of amplified material.

Are these new primers or old ones that have worked in the past?

Yes

I am using different primers for nested PCR

For primary PCR I am using AMA-1 primers

And for Nested PCR I am using HVR-1 primers

HVR-1 is 417 bp in length

Gel picture is attached herewith

All bands are low than ladder

AllI are primers dimers

1. Most of the info you gave in the question did not help much. All compoents you gave with a 'volume (uL)'. You should gave components' concentrations (uM). You did not mention the Tm (melting temperature) of your primers neither, so it is hard for other people to do the diagnosis on your problem for you.

2. The picture you attached is hard for us to see the position of the bands, including the DNA markers. You should take the picture from above the gel. But, make sure you have proper UV-protection shield to protect you from the UV light.

Tm of AMA1 Reverse Primer is......46.2

Tm of AMA1Forward primer is.... 47.1

The primers i am using are 2 yrs old and they previously they were working.

The sequences of primers i am using are given as follows: AMA1_FORWARD_ACAAAAATGAGAAAATTATACTGC

AMA1_REVERSE_TTTTAATAGTATGGTTTTTCCATC

AHVR_FORWARD_CTGGAACTCAATATAGACTTC

AHVR_REVERSE_TTCTTTCTAGGGCAAACTTTTTC

Your Tm for primer 1 and primer 2 is 46.2C and 47.1C respectively. But, you set your annealling time at 55C. I think the annealing time probably is too high for it. You can re-set your annealing time at 46C and try to run it again. Make sure include a positive control if you can, and add a DNA marker (ex. 1 kb DNA markers) lane when you run a gel.

Tell us your results after you done.

I am confused. Did you use the condition set below to run your 'primary PCR' with primers AMA1 and AMA2??

Conditions: Stage 1: Primary Denaturation: 94 degree for 5 Mins Stage 2: Denaturation: 94 degree for 1 minute Annealing: 55 degrees for 1 minute Extension: 72 degrees for 2 Minutes Stage 3: Final Extension: 72 degrees for 7 Mins No. of Cycles: 35

Also, is that picture you attached (1) the results of 'primary' PCR or (2) the results of nested PCR after primary PCR?

Results of nested PCR after primary PCR

Yuan-Yeu Yau Yes the conditions I have mentioned above are both for AMA-1 and HVR i.e Primary and nested PCR respectively...except the change in final extension of Nested PCR (72 for 2 minutes)

AHVR_FORWARD_CTGGAACTCAATATAGACTTC ....Tm....49C AHVR_REVERSE_TTCTTTCTAGGGCAAACTTTTTC.....Tm... 53C

In that case, why don't you set the annealing temp at 45~46C for AMA primers and 48~49C for AHVR primers. Please update us after you re-do PCR.

@ Mehwish Nawaz, by the way, why did you use 'primary PCR' and then 'nested PCR' to amplify a gene? Are the primers using in the primary PCR 'degenerate primers'?

In Primary PCR i have to amplify AMA1 gene while in nested PCR i have to amplify HVR region of AMA1 gene

Yes sure Sir, will definitely inform you...

Ok, I understand now why you do two PCRs. Thanks.

Yes Sir

Mehwish Nawaz make sure , along PCR conditions proper Electrophoresis and use of GelDoc is also important . Are you sure that you are performing Electrophoresis in a proper way? Can you share gel pictures?

Yes Sure

Gel picture attached herewith contains PCR products

Annealing temp for primary PCR was 46 degrees Celsius

While for nested PCR annealing temperature was set at 48 degrees Celsius

And DNA ladder of 1 kb was used...

It looks like you have a short band in some lanes. How long it the HVR region PCR product suppose to be? What is the size of the smallest DNA marker in the 'DNA-marker' lane? There is a lot of EtBr in your gel. You can use less EtBr.

Hey Mehwish!

I just went through all the discussion. It is quite interesting.

I had a lab fellow, she was working the same gene (may be you both have same topic). This was problem with her as well but she managed to get results.

First of all, u need to look about your conditions. You should try Master mix instead of manual PCR ingredients (as these things aren't much different but it matters sometimes).

U should also need to check environment of your preparation as it can effect your pcr. u need to prepare your pcr in Laminar Flow Hood. plus u should also check accuracy of your pipette u r using. Also u should consider sample DNA concentration. U should try 1ul. (These arent technical things but in labs like ours it matters, as i have been through this).

Now lets consider some technical reasons.

U should lower ur annealing temperature as you primers have lower %age of GC Content. I think my lab fellow were using 51 or 53 annealing temperature. Your annealing time is also more. u should change it. do it one by one, not all at the same time.

Smallest band of DNA ladder is of 500bp while HVR of AMA1 is 417 bp

I used 4 microlitre of EtBr in 30ml of 1XTBE

Yes she was our senior

But she was working on MSP-1 and MSP-2 of Plasmodium falciparum

Hi

Mehwish Nawaz Do you Know the target region`s length?

Mehwish Nawaz ladder has 500bp and region comprises 41bp so how you can compare these? By these way they are your results not primer dimmer. one more do you know the primer`s length?

yes 400-500 bp is my target length

Mehwish,

If the last visible band (on gel) in the 'DNA marker' is 500 bp, the possible band on the gel looks like smaller than what you want (417 bp). What is the brandname (company) of your 1 kb DNA markers? I would like to see their band patterns

I am using Thermo scientific 1kb DNA ladder

Dear Mehwish Nawaz,

Total volume for PCR reaction mixture - 25 μl

Reaction mixture - 1× Taq buffer, 0.25 mM each dNTP's, 1 μM each forward and reverse primers, 1.25 units of Taq polymerase enzyme and 10-100 ng/μl of template .

Conditions:

Stage 1: Primary Denaturation: 94 degree for 5 Min

Stage 2: Denaturation: 94 degree for 1 Min

Annealing: 55 degrees for 30 Sec

Extension: 72 degrees for 1 Min

Stage 3: Final Extension: 72 degrees for 7 Min

No. of Cycles: 30

I will also suggest to do gradient PCR to find right temperature for amplification. In this case, you can try between 50-60 C.

Good Luck,

Prem

Prem Prakash Das Thank you so much for the conditions and reaction mixture protocol

but unfortunately there is not Nanodrop in our lab , so how should I take DNA in Micrograms (Or how should i check its quantity and purity)

Using NanoDropTM machine is very convient, but you can also use a conventional spectrophotometer and a 'quartz' cuvette to measure DNA concentration and purity. See attachment.

Respected Yuan-Yeu Yau Thank You so much