Dear Lutz

Primers often work if the mismatch is not bigger than the place, meaning Target is an A or T and the mismatch a C or G. The other way round would work. But you may have modified specificity. This has to be checked. I do not dare to give a final theoretical answer. I would test it. If it works and the Validation give useful results, it works, otherwise not.

According my experience with TaqMan assays first three bases are important for starting of 5'-3' exonuclease activity of Taq polymerase.

Degradation of the probe is in the base of the fluorescence changes measured by the apparatus and these changes are used to evaluate PCR efficiency. In case of loss of degradation of the probe you will have incorrect fluorescence measurement. If you perform gel electrophoresis of your PCR product you can compare PCR efficiency and PCR product accumulation. Some controls are needed.

Actually in this case you can remove manually first C base at the 5' end without dramatically changes of the Tm of the probe. Alternatively you can remove first three bases ( G base should be avoid as as 5' base for the probes because it is natural quencher of the reporter dye) and Tm still remains appropriate for TaqMan assay. Of course if you decide that Tm is too low you can add several bases at the 3' end of the probe if the consensus target sequence allows.

Next web site is used for evaluation of Tm of the probe

http://biotools.nubic.northwestern.edu/OligoCalc.html

Dear Lutz,

I think that the mismatch is at the 3'-end of the probe? The mismatch will have no effect on the efficiency of the assay, because the Tm of the probe is high enough and the mismatch is at one end of the probe. Sometimes it is even necessary to but an additional base at the 5'-end to separate e.g. a G from the fluorophore. 

target: 5'- TACGTCGCTCGCTCGCTCAATGG-3'

x-------------------------------------------

Probe: 3'- CTGCAGCGAGCGAGCGAGTTACC-5'

Cheers!

Henno

Thanks Rene, Dimitar and Henno!

Henno, you pointed to a mistake I made. The correct scheme (it is not the 'real' probe and target) should read in the following way:

target: 3'- TACGTCGCTCGCTCGCTCAATGG-5'

                  x-------------------------------------------

Probe: 5'- CTGCAGCGAGCGAGCGAGTTACC-3'

So the mismatch is at the 5' end of the probe. We did already extensive validation experiments with this probe. A simple proposal was, to shorten the probe sequence by one base (the mismatching  5' base).

The question is, whether the 5' mismatch would effect the 5'-3' exonuclease activity of the Taq-polymerase or not. You all now for sure the paper of Holland which describes the principle of the TaqMan assay (http://www.pnas.org/content/88/16/7276.full.pdf). T

What I know by my own experience is that the effect for the efficiency of a PCR primer with a mismatch at the 5' end will be small. But the for the 5'-3' exonuclease efficiency the effect may be larger.

Kind regards

Hello,

the mismatch at 5’ end of the probe should not be relevant for probe annealing and it makes it easier exonuclease activity. Then I think that is not important for success of assay. The benefit is reading of both sequence target, with mismatch and without mismatch, but there could be the influences for specificity and efficiency. For verify this, I would get the probe without mismatch and I would be two test. One test for efficiency: to prepare the scalar diluitions and test them, in the same plate, with both systems, then to verify the Cq and the regression curve. For specificity: to test, both systems in the same plate with sequence target with mismatch and without mismatch.

Sorry for my English.

Best regards

Elisa

Thanks Elisa!

I think you are right, that it could even make the 5' nuclease activity easier.

In a text book on enzymology primer for recombinant DNA technology readable via google books I  found the following: "For cleaveage by the 5' nuclease activity of Taq polymerase the preferred structure is the displaced DNA or a bifurcated structure with a free 5' end." This would mean, that a 5' mismatch could possibly enhance the 5'nuclease activity and efficiency.

Of course, as you said, experiments would be the best solution to verify this theoretical assumption.

Best regards

Hello again!

Something about Taq polymerases.

The citation - "For cleavage by the 5' nuclease activity of Taq polymerase the preferred structure is the displaced DNA or a bifurcated structure with a free 5' end." - is valid for wild type Taq polymerases. But the enzymes used in master mixes are quite modified recombinant Taq polymerases.

TaqMan probes are designed with higher Tm (about 64-70 degree Celsius) in contrast to the primers. This high Tm of the probe ensure stable binding between target DNA and TaqMan probe at about 60 degree Celsius which guarantee start of 5'-3' exonuclease activity instead of detachment of the probe.

Regards

Sorry for the interrupt.

I am just wondering what about mismatch in the internal sequence of probe. Will it makes a drastic effect on amplification efficiency?

Attached. Highlighted in red is the probe I have designed, covering a wide range of species.  Asterix implies homogenous nucleotide.

Is it worth to have a try on this probe?

Regards

Lee Lee

Hi Lee Lee,

This probe is not acceptable. There are too many mismatches. In case this is the only region for probe you can try to design degenerated probe, but I'm not sure about efficiency of reaction. Better case is if you can find more conservative region for probe.

Regards

Hi Lutz

If your strands are complementary they should look like this (one antisense: target and one sense: your probe with the dye at the 5'-end),

target:          3'- TACGTCGCTCGCTCGCTCAATGG - 5'

                          X |  |  |  | |  |  |  | |  | |  | |  |  | |  |  | |  |  | |

Probe: 5'-[FAM] CTGCAGCGAGCGAGCGAGTTACC -3'  

In this case, Taq Pol is copying the reverse strand (target or template) and the 5'-3' exonuclease activity of the enzyme encounter the mismatch bases (in bold), but most likely will not matter since the rest the remaining bases are aligning and greatly contributing to a high Tm. The mismatch will not have an effect in PCR efficiency since the probe does not serve as primer (do not amplify). I bet this mismatch does not greatly affect you end result.

Jesus

Dear sir Lutz Grohmann

This article exactly answers your question.

Article Recent sequence variation in probe binding site affected det...

....... All RSV-B viruses, rRT-PCR positive and negative, had a mismatch at the 1st base (T/G) in the probe site implying the PCR conditions likely tolerated this mismatch. .....

Hope you already solved the problem.

I was roaming with similar problem for COVID-19.

This article was published after your question.

Divya