I am very sorry to encroach your time by asking very basic questions.
1. I understood that a gene is a nucleotide bases in the template strand (non-coding strand or non-sense strand). Am I right?.
2. Our interest of the gene may be located in any one of the DNA strands, i.e. either in forward strand or reverse strand. While searching NCBI Gene database for an interest of gene query, there will be a display from which I can download a DNA sequence of that gene in GenBank or Fasta format. From that, How I can get the information that the query gene is located in forward or reverse strand.
3. In Genbank, the DNA sequences represent the forward strand only. Isn't it?
In addition to the arrows, when you download the sequence of a gene, say from the UCSC browser, you will see the gene orientation from "strand=". Here are two examples, the first is a gene that is on the minus strand, i.e. it starts from the right and goes left, the second is a gene on the plus (forward) strand, i.e. it starts from the left and goes right. The same is when you download flat files that contain start, end, chr location and so on. When you download a gene sequence from UCSC that is on the minus strand, you can specify to have the sequence from the minus strand, so that your gene begins with the first nucleotide rather than the last. In this case, the coordinates will go from big to small.
>hg19_knownGene_uc003mbr.3 range=chr5:171760503-171881527 5'pad=0 3'pad=0 strand=- repeatMasking=none
AGTGCGCGCCGAGCGAAGGGCGGCGGCGGTGGCGGCGGCGGCTCGTGCTC
GGCCCCGGCTGCGATTGCGCTCAGCTCCAGGTTCCCTGCCCGCGGCGGCG
CGCCCCCAGCGCTCCCTGCACCCCGCGCCACCCGCACCCGCGCTCGGCCC
>hg19_refGene_NM_001142651 range=chr5:172068276-172118533 5'pad=0 3'pad=0 strand=+ repeatMasking=none
CTGCCGCCCGCCGGCTCGCCCGTGCAGCTGCGATGCCCCGGAGCGTCGAC
CCCGGTCCTGGTCCCTGGCCCGCCGCGTAATTAGCCTCCGCGCGCCCAGA
GCGCGCCGCCGCCAACGCCGCGCCCGACGCAGCGATGGGCAACACGGTGC
ACCGGACCCTGCCAGgtacgccggggagccctgcccgggaggcgggcgcc
- Badges
- Science topic
- Similar topics
- Biological Science
- Genetics
- Genetic Analysis