For example, I need to find all sequences flanked with two sequences CAGGAACGCTACC and TGCGCTTCGACAG:
CAGGAACGCTACC...NNNNN...TGCGCTTCGAC, where ...NNNNN... means any sequence with any size, or size in a certain range.
I used to do this long time ago, but now I don’t remember what parameters need to be changed to get such information
You need to 1) reverse and complement one of those sequences if they are PCR primers 2) choose the genome from the set and 3) optimize for "short matches"
Good luck!
Hi Berzhan Kurmanov
the other possibility is to make an "in silico PCR" with those probes.
uCSC and NCBI offer this tool.
all the best
fred
Berzhan,
Use NCBI Blastn (RefSeq Genome database) using a merging of the two sequences (CAGGAACGCTACCTGCGCTTCGACAG) as a query.
Choose the appropriate genome and select for highly similar seqs. Parameters are automatically adapted for short sequences (the search uses the two polarities).
Such a search produced 34 hits in the human genome.
Download results as a csv or txt file. Then sort the interesting hits on query starts and ends: you want sequence 1 (13 nt long, 1 to 13) and sequence 2 (11 nt long, 14 to 24) to be both present on a same chromosome/contig/fragment and in
correct polarities. After analysis, a single hit remained: chromosome 13, between 31139844 and 112844036 (see the attached csv file).
Best wishes,
Philippe
- Badges
- Science method