I have the mRNA sequence for myoglobin in quail. But I cannot figure out how to use this to find the dna sequence for the gene so that I can design primers for it. The BLAST website is still fresh to me and I have failed to find out what databases and search systems to use.
Quail myoglobin mrna:
gaggcaacagccgtaggcagcactcgagacccgtctgtctctgccaccagcaaaccatggggctcagcgaccaggagtggcaacaggtcctcaccatctgggggaaagtggaggccgacattgctggccatggacatgaggttctgatgagacttttccgtgaccaccctgagactttggatcgctttgagaagttcaaaggcctgaagacccctgatcagatgaagggctctgaagatctgaagaaacatggagctaccgtcctcacccagcttggcaaaatcctgaagcagaagggtaatcatgagtcagagctgaagcccctggctcaaacccacgccacgaagcataaaatcccagtcaaatatctggagttcatttctgaagtcattatcaaggtcattgctgaaaaacacgcctcagactttggggccgagtcccaggcttcgatgaagaaggccctggagctgttccgaaatgacatggccagcaagtacaaggagtttggtttccagggttagcatgtatacagaagggcaccacgatggaggccttgccatgcgtctcagagtagcatccccagcactattctgggcatcttccaactgaccatccatgacgtgtgggaatgcttcgatgagaggccaagagtcaccctaggcagcacagaggcactcagagtgatgtccatgataaattgttgccctttcctggcttcatgtatgcaaaagaaataatgttttcttaggaaaaataatataaggggttatctgtcaccttctgctta
The mRNA is complementary to the coding sequence of the DNA. Find the complement, and search for that sequence. As for designing primers, you should consider the nature of shustrings (shortest unique sequence) for the locus of your gene. Does this help; can you be more specific?
Mainly I'm having problems searching the NCBI website to find the data I need. Where do I find the genome for quail and search it, for instance. The whole genome sequence was released for quail last year but I am having trouble actually getting to it.
I have seen this but there is no way on there to actually search through the data
The suggestion is that the data of quail is merged with that of chicken. Also, there is given on the website the email address of the Japanese researchers who manage the data. It should be simple enough to send them email and ask the direct question - can you supply me with an .FAS file? If you have the file, then searching is easy. Indeed, a simple Python or Perl script should be enough.
I looked again. Download the .fasta file, and you have all you need in order to perform your search. You know the genome and you know the sequence you seek. You can find where the two match, using BLAST or similar software. From that, you need something like 20 bp to uniquely identify a locus that is transcribed; see here for some detail on primer length
https://www.researchgate.net/post/Not_a_question_but_an_invitation_to_discussion-Shannon_Chaitin_and_the_genome
If for some reason you cannot locate quail, you can look in related birds and find homologous sequences. Design primers from the related species (using degenerate primers if needed) and this could be a start. Good luck!
- Badges
- Science method