Hi there,
I am trying to design allele specific primers for KASP assays to validate the SNPs from GWAS results. However, few of my SNP sequences have two or more SNPs only few base pairs apart and am having trouble designing primers for them.
Please see the example sequence below:
TGCAGATG[T/C]ACAAATTATAAATTATTTGACAAATAGAT[A/-]ATGTTATTTCATATATT