How adhesion can be improved for Cu to Al, glass using sputter deposition?

More Shashi Kant's questions See All

Is there any solar electric power plant having the concentrated photovoltaic modules?

The solar photovoltaic (PV) power plant uses commercial (non-concentrated) PV modules which are quite simple in design and reliable. They can work on fixed orientation and don't need the moving...

16 February 2021 3,796 9 View

Is it safe to open educational institutes amid new cases of Covid-19 without completion of vaccination??

Vaccination is in its First phase in India. The front line is to be vaccinated yet. In this situation opening of institutes may be dangerous for the life of children.

01 February 2021 660 2 View

Control in microstructure with growth inhibitor?

Dear researchers, I wish to understand the role of grain growth inhibitor in controlling the microstructure of the ceramic pellet. How it controls the growth? Also, I wish to know the grain...

15 January 2021 3,859 3 View

Does behavior (shy vs bold; rare vs abundant) and flock size (small vs large) of bird species play role in niche partitioning among sympatric species?

Sympatric birds may avoid competition via multiple strategies - by different activity period, different diet, different microhabitat etc. Has any one looked into behavior of sympatric birds as...

11 January 2021 9,600 1 View

Buckling of Smart composite plates using FEM ( MATLAB code)?

Can anyone help me with the FEM coding for Buckling of composite plates using the FSDT or HSDT - Source or the helping material (textbook, research paper etc) - Geometric stiffness matrix...

03 January 2021 3,059 3 View

Optimization technique in ball mill?

Hi all, I wish to know about a common problem faced by most of the researchers who are dealing with ceramic materials that my ceramic powder is sticking with the balls after the operation. can...

02 December 2020 8,232 3 View

Smear in PCR product after purification, how to get rid of it?

I've done a PCR using primers Forward: CGCCATCAAGGTACCAGTTGA and Reverse: CAGGCTCAGGTACAGCTGGTGG AGTCTGG saw a band at around 400bp and purified my PCR product using QIAquick PCR Purification...

28 November 2020 1,701 7 View

Exergy destruction mathematical calculation in kW?

somebody, please elaborate on how to calculate exergy destruction in kW units. from Aspen HYSYS I found mass exergy with kJ/kg unit and i don't know how to calculate it by using Aspen HYSYS and if...

25 November 2020 2,675 3 View

I am looking for the dataset to test the algorithms for Radar Emiiter Classification?

I am working on Radar Emitter Classifiers and I want test my codes. unfortunately I'm unable to find a dataset to test my algorithms. I'll be glad if someone can help me with this...

04 November 2020 3,988 3 View

How to link excel with Aspen plus?

Is there any way to connect excel data sheets with aspen plus as inputs to perform parametric analysis?? I want to change input parameters for a certain range to see system performance

28 October 2020 2,174 3 View

Why can't make aluminum nitride film successfully by use sputter?

We use reactive sputtering process to make aluminum nitride film, and want to make c-axis aluminum nitride film on a silicon substrate, but the crystal orientation cannot be seen with...

03 March 2021 7,975 3 View

Is there a powerful system for the security of the systems distributed on IoT systems?

02 March 2021 3,858 10 View

How Relativistic effects is one reason for lanthanide contraction?

The Lanthanide contraction which is the decrease in ionic radii of the elements in the lanthanide series from atomic number 57, lanthanum, to 71, lutetium, is due to poor shielding of the 4f...

01 March 2021 2,272 4 View

What thickness need for ITO to use as conductive layer?

I want to do RF sputtering of ITO on glass substrate using magnetron sputtering. what thickness do i need to make it good conductive layer to use it for PSC. Moreover, whats about thickness of...

01 March 2021 395 3 View

Adherance of Polyaniline coating over stainless steel?

Is the electropolymerisation of polyaniline coating over stainless steel (SS) via Cyclic voltammetry technique is really adherant? Else how to improve the adhesion of the coating, whether any...

01 March 2021 8,220 2 View

How to separate water from glycerol solvent in a solvent recovery vacuum distillation column?

I am currently doing my third year design project. I have been assigned to design a glycerol recovery column in vinyl acetate monomer production. The process unit before the recovery column is an...

01 March 2021 9,525 4 View

Is there a method of determining feed digestibility without the need to re-pellet the feed?

I am aiming to determine the ADC values of a commercial fish feed, but I do not have a steam pelleter or extruder available to me. Ideally, the pellets could be coated with some inert marker....

28 February 2021 7,967 3 View

1 nm thick MgO thin-film to be deposited on Si wafer using thermal evaporation. What will be the optimum deposition conditions?

Favourable conditions of base pressure, rate of deposition. Also, by which characterisation technique to be used to verify the thickness of the deposited film.

28 February 2021 3,640 3 View

How to immerse bricks in wax ( for coating ) ?

Do we immerse the bricks horizontally or vertically ? #bricks#waterproofingsurface#civil#engeenering#chemicalengineering#wax#parafinwax

28 February 2021 6,685 2 View

For gelatin coating for culturing HUVEC.Should the gelatin be made in sterile water or PBS? Do I need to autoclave the gelatin soln after making it ?

I want to use 0.1% gelatin. Should that be made in PBS or sterile water? Should I autoclave the gelatin soln after making it in water/PBS?

28 February 2021 274 2 View

Muhammad Shahbaz Anwar

You can one of the following as an adhesion layer,

just 5 nm

Ti , Cr, Ta or MoGe

Jose-Miguel Garcia-Martin

A buffer layer of Cr or Ti, about 3 nm thick, promotes good adhesion between metals and glass.

Shashi Kant

thanks a lot Dr. Jose-Miguel Garcia-Martin and Dr. Muhammad Shahbaz Anwar