What are the main Sensations and Symptoms in fibrilar rupture of the Abdominal Muscle in Tennis Players?

21 May 2024 0 1K Report

I need to know what are the main sensations and symptoms, tennis players feel when their abdominal muscle suffers this type of injury.

Thank You

Badges
Science topic

More Álvaro Romero's questions See All

Is there any solar electric power plant having the concentrated photovoltaic modules?

The solar photovoltaic (PV) power plant uses commercial (non-concentrated) PV modules which are quite simple in design and reliable. They can work on fixed orientation and don't need the moving...

16 February 2021 3,796 9 View

Control in microstructure with growth inhibitor?

Dear researchers, I wish to understand the role of grain growth inhibitor in controlling the microstructure of the ceramic pellet. How it controls the growth? Also, I wish to know the grain...

15 January 2021 3,859 3 View

Does behavior (shy vs bold; rare vs abundant) and flock size (small vs large) of bird species play role in niche partitioning among sympatric species?

Sympatric birds may avoid competition via multiple strategies - by different activity period, different diet, different microhabitat etc. Has any one looked into behavior of sympatric birds as...

11 January 2021 9,600 1 View

Buckling of Smart composite plates using FEM ( MATLAB code)?

Can anyone help me with the FEM coding for Buckling of composite plates using the FSDT or HSDT - Source or the helping material (textbook, research paper etc) - Geometric stiffness matrix...

03 January 2021 3,059 3 View

Does anyone have experience using High Molecular Weight DNA Extraction Kits for extracting DNA from plant leaves?

Hi there, I'm looking for a High Molecular Plant DNA Extraction Kit for subsequent Nanopore sequencing. Does anyone have experience using commercially available kits? Any...

03 January 2021 9,487 4 View

Optimization technique in ball mill?

Hi all, I wish to know about a common problem faced by most of the researchers who are dealing with ceramic materials that my ceramic powder is sticking with the balls after the operation. can...

02 December 2020 8,232 3 View

Smear in PCR product after purification, how to get rid of it?

I've done a PCR using primers Forward: CGCCATCAAGGTACCAGTTGA and Reverse: CAGGCTCAGGTACAGCTGGTGG AGTCTGG saw a band at around 400bp and purified my PCR product using QIAquick PCR Purification...

28 November 2020 1,701 7 View

Exergy destruction mathematical calculation in kW?

somebody, please elaborate on how to calculate exergy destruction in kW units. from Aspen HYSYS I found mass exergy with kJ/kg unit and i don't know how to calculate it by using Aspen HYSYS and if...

25 November 2020 2,675 3 View

PLS-SEM generalizability issue?

I'm developing a readiness assessment model regarding contractors' preparedness for a specific activity, in order to do so, a survey study was carried out and the data analyzed with PLS-SEM to...

24 November 2020 399 1 View

I am looking for the dataset to test the algorithms for Radar Emiiter Classification?

I am working on Radar Emitter Classifiers and I want test my codes. unfortunately I'm unable to find a dataset to test my algorithms. I'll be glad if someone can help me with this...

04 November 2020 3,988 3 View

Can you share me how teacher education is managed in your respective national educational system?

I feel that the practice in teacher education in my country is below the expected performance level due to very poor management system. Hope I will learn something from your experiences.

02 March 2021 1,516 4 View

Can we distinguish the type of free fluid inside the pelvic and abdominal cavities whether blood or serous fluid using the ultrasound?

during ultrasound examination of acute abdomen, sometimes we see free fluid , can we know the type of fluid ,whether blood or not , using ultrasound only? if yes , what are the sonographic...

01 March 2021 7,476 4 View

Is it Ok to decline to write a chapter for a IntechOpen to the lack of experience?

I have been asked by IntechOpen to write the chapter for a book they are going to publish, but as I don't have enough experience in the area they proposed me to write I declined their offer. Now...

24 February 2021 2,802 4 View

Which polarizers are usually used to measure the birefringence of zebrafish muscles?

I already found several publications on that topic, however, the specifications for the used filters are often missing. Some more specific information than "fish is placed between to polarizing...

23 February 2021 1,934 1 View

Do you have papers on hindlimb myology of birds to share?

Hi all! we are looking for papers (or information) on muscles of the hindlimbs of birds (extant and extinct) that include the intrinsic muscles of digits. Any help will be more than welcome! Thanks!

22 February 2021 7,186 3 View

Do you have papers on hindlimbs myology of birds to share?

Hi all! My work team and I are looking for papers on muscular descriptions of the hindlimbs of birds (extant and extinct) that include the intrinsic muscles of digits. Any help will be more than...

22 February 2021 8,330 6 View

Any Homemade Organic Synthesis Practices?

Hi everyone, I am a teacher of Heterocycles Synthesis, Is there a home practice that you recommend for undergraduate students? A simulator would also be useful Due to the pandemic, students...

18 February 2021 2,769 4 View

Are ZnS nanoparticles moisture sensitive?

Hello Everyone, I tried to form ZnS nanoparticles using the hot injection method and was able to form the same (confirmed by XRD). When I centrifuged, after the reaction I got a kind of white...

17 February 2021 1,709 3 View

What is the minimum number of studies in each category required for a multiple subgroup analysis to be viable in a meta-analysis?

Cochrane Handbook mentions subgroup analyses are only warranted if there are more than 10 studies (I have 28), and if they are distributed evenly among categories of subgroup. I am wondering if...

17 February 2021 3,467 4 View

Is it appropriate to use AIDA model (Assessment of Identity Development in Adolescence) on a non-clinical sample?

I am researching emotion regulation and identity development in adolescence. I've come across several inventories for assessing identity development and it seems like the AIDA scale is the most...

16 February 2021 1,261 1 View