03 August 2013 2 9K Report

Seeking information on attention problems in the cases of high functioning autism

More Dennis C Harper's questions See All
How to carry out micro preparation of Zn-2 (Zamak 2) sample surfaces?

I am currently struggling to achieve a good surface finish on mounted Zn-2 samples. Both grinding and polishing (with SiC, silica and diamond) resulted in embedding of the grinding/polishing media...

11 June 2024 2,055 0 View

FFPE mouse femurs appear to have internal bubbles?

I am wondering if this is a technical issue that occured during processing. I have murine femurs that were decalcified in 15% EDTA over 2 weeks and then processed and I embedded them into FFPE....

02 April 2024 6,382 2 View

Is it necessary to include an FMO for 7-AAD dye in your Flow Cytometry experiment? If not, why?

I'm optimizing a flow cytometer experiment and one of my three stains is a 7-AAD Live/Dead stain. The other stains in my experiment are staining for CD34+ and CD45+ cells. Is it necessary to...

01 April 2024 3,060 0 View

What is best way to get lowest adsorption site at subsurface of high entropy alloys?

I am currently studying diffusion of oxygen in high entropy alloys. I want to calculate the activation energy from an adsorption site on the surface to the subsurface. I placed the oxygen atom...

26 March 2024 3,268 0 View

Examples of gender norms that affect men and women's participation in agriculture?

It is a course unit called gender and social economic issues in development ARX 1201

07 January 2024 365 0 View

Is it necessary to to conduct independent simple regressions for a multivariate regression model or this can be derived from the multiple regres?

The objective here is to determine factor sensitivities or slope coefficients in a multiple ols regression model.

17 August 2023 7,825 5 View

Does anyone had problems installing Cytoscape in Ubuntu 22.04.2 LTS?

I am trying to install Cytoscape in Ubuntu 22.04. I followed the instructions on the official website and installed Java 11, 17 and 18. None seems to work. I had this error every time: Error:...

30 May 2023 9,889 2 View

Why is it that when I open a structure and I select atoms in Vesta it crashes immediately?

I am trying to work on a structure in Vesta. But after opening, it crashes when I select atoms to delete. Any help would be deeply appreciated

07 March 2023 5,805 4 View

How can schools, families and religious institutions collaborate to promote healthy development among youth and adolescents?

I am investigating how schools, families and religious institutions collaborate as partners to promote and support the healthy development of adolescents? Evidence so far suggests that some degree...

11 February 2023 7,146 5 View

Working primers for human NPC1 and TrkB qPCR?

For one of our experiments we are planning to run a qPCR on cDNA from human samples. In our first test, we found that our primers for TrkB (forward: ACAGTCAGCTCAAGCCAGACAC, reverse:...

24 January 2023 4,508 3 View

Similar questions and discussions
Request Python code?

Request Python code from this article : Gender equity of authorship in pulmonary medicine over the past decade. THANKS!

08 August 2024 6,242 2 View

GC-MS retention index prediticon?

Hello experts, Does anyone know any free software about retention index prediction ?

08 August 2024 7,403 2 View

Why does everyone use vs code?

Visual Studio Code (VS Code) has become a popular choice among developers for several reasons: 1. **Free and Open Source**: VS Code is free to use and open source, making it accessible to...

07 August 2024 7,013 4 View

Is there an alternative to a multinomial regression which allows the DV to be non mutually exclusive?

I am trying to analyse data from a survey examining what variables affect teachers perceived barriers to incorporating technology into their classroom. I have 5 predictor variables however my DV...

06 August 2024 1,752 3 View

Is an invitation to join the editorial board of Clinical Cardiology Updates a scam?

I received an e-mail invitation to join the editorial board of Clinical Cardiology Updates. While I have published a few articles related to cardiovascular disease, there are lots of colleagues...

06 August 2024 8,981 8 View

Why do we equate male and female arousal?

Women, on the other hand, can become physically aroused (increased blood flow in the reproductive organs) without becoming psychologically aroused even in the slightest. (Robert Weiss)

05 August 2024 9,537 2 View

How can i do multivariate Time Series forecast using MLP, ANFIS and LSTM?

I need the python code to forecast what crop production will be in the next decade considering climate and crop production variables as seen in the attached.csv file.

05 August 2024 2,977 3 View

I need the datasets of Microgrid for system identification?

Hi I am working on data driven model of the microgrid, for that, i need the reliable datasets for the identification of MG data driven Model. Thanks

02 August 2024 5,748 4 View

Should I remove an item from a scale to raise Cronbach's alpha and McDonald's omega or is it better to leave it if they are both over .7 already?

Hello! I have this scale which had 10 items initially. I had to remove items 8 and 10 because they correlated negatively with the scale, and then I removed item 9 because Cronbach's alpha and...

01 August 2024 4,606 7 View

Talking therapies for bipolar, psychology?

what is the best research evidence for psychological interventions for Bipolar?

01 August 2024 6,023 2 View

Our partners will collect data and use cookies for ad personalization and measurement. Learn how we and our ad partner Google, collect and use data. Agree & close