For one of our experiments we are planning to run a qPCR on cDNA from human samples. In our first test, we found that our primers for TrkB (forward: ACAGTCAGCTCAAGCCAGACAC, reverse: GTCCTGCTCAGGACAGAGGTTA) and Npc1 (Forward: TGCTGTTGTGCAGCCTCTCTGA, reverse: CCACAAAGGCTGACATCTGCAG) did not work. Is there anyone that has alternative primer sequences available which we can test in our setup?
your NPC primers look good on primer blast. Are you sure that it is expressed in your cDNA sample and also that other primer sets work on your cDNA template. If these are old primers stored in water or inherited from another researcher it would be worth ordering new primers with the same sequence
Paul Rutland thanks for your comment! On the same cDNA samples we also tested 2 house keeping genes and around 10 other genes of interest and all worked without any issues. The primers are newly purchased in December 2022, so long time storage etc. should not be an issue. According to our experimental setup we would expect to retrieve a signal for both Npc and TrkB in at least a part of our samples.
Thank you Dennis M Meesters . You could still get negative results from a SNP under the 3' end of either primer so it might be worth checking dbsnp for these genes just in case there is a linkage disequilibrium between a snp and your researched disorder which is located under one primer but your original request for alternative primer sets is looking like the best approach
- Badges
- Science topic
- Similar topics
- Biological Science
- Biochemistry
- Biochemical Techniques
- Analytical Chemistry
- pH