It is a course unit called gender and social economic issues in development ARX 1201
I am currently struggling to achieve a good surface finish on mounted Zn-2 samples. Both grinding and polishing (with SiC, silica and diamond) resulted in embedding of the grinding/polishing media...
11 June 2024 2,055 0 View
I am wondering if this is a technical issue that occured during processing. I have murine femurs that were decalcified in 15% EDTA over 2 weeks and then processed and I embedded them into FFPE....
02 April 2024 6,382 2 View
I'm optimizing a flow cytometer experiment and one of my three stains is a 7-AAD Live/Dead stain. The other stains in my experiment are staining for CD34+ and CD45+ cells. Is it necessary to...
01 April 2024 3,060 0 View
I am currently studying diffusion of oxygen in high entropy alloys. I want to calculate the activation energy from an adsorption site on the surface to the subsurface. I placed the oxygen atom...
26 March 2024 3,268 0 View
The objective here is to determine factor sensitivities or slope coefficients in a multiple ols regression model.
17 August 2023 7,825 5 View
I am trying to install Cytoscape in Ubuntu 22.04. I followed the instructions on the official website and installed Java 11, 17 and 18. None seems to work. I had this error every time: Error:...
30 May 2023 9,889 2 View
I am trying to work on a structure in Vesta. But after opening, it crashes when I select atoms to delete. Any help would be deeply appreciated
07 March 2023 5,805 4 View
For one of our experiments we are planning to run a qPCR on cDNA from human samples. In our first test, we found that our primers for TrkB (forward: ACAGTCAGCTCAAGCCAGACAC, reverse:...
24 January 2023 4,508 3 View
Good day scholars, I am doing a descriptive study and want to administer a standardize test, is it possible?
21 September 2022 6,517 1 View
I will be glad to know if there is a proven answer to my question. from the knowledge of the effect of flavonoid extract of phyllanthus amarus, flavonoid have antioxidant properties and...
05 June 2022 2,429 0 View
Articles on" Gender disparities i leatherwork education"
07 August 2024 2,500 0 View
Women often complain that their husbands never touch them unless they want sex. (Michele Weiner-Davis)
02 August 2024 7,778 2 View
Women need to feel a degree of sexual intimacy before sex becomes desirable… For women, intimacy sometimes results in sex; for men, sex sometimes results in intimacy. (Marina Muratore)
31 July 2024 8,860 0 View
Women associate affection with love. … Men associate affection much more directly with sex. … Men see affection of any kind as a sexual invitation. Many women find this bewildering. (Kramer &...
30 July 2024 9,498 2 View
Of the 82 percent of women who said they masturbated, 95 percent could orgasm easily and regularly, whenever they wanted. (Shere Hite)
23 July 2024 2,807 4 View
When men see an attractive woman, they fantasise about sex. When women see an attractive man, they fantasise about a relationship – charming, agreeable company over dinner, friendship and comfort....
20 July 2024 2,500 0 View
May I request for change of pofile for this email address? It belongs to the ofice of the head of institution but the name attached is different. Kindly also include [email protected] being the...
17 July 2024 1,145 0 View
There is a startling gulf between fantasy and what a woman is really seeking in a sexual relationship and she may find this very disturbing. (Sheila Kitzinger)
09 July 2024 8,390 0 View
Identity and fashion have a link in the physical world and thesis aims to claim the same to be true for the virtual world. If this is true then the same elements for businesses should apply to...
09 July 2024 6,214 2 View
I would like to know whether AI systems also have gender like male or female or is it neutral?
07 July 2024 6,646 4 View