Did anyone had an experience with [ LCO 1490 & HCO2198 ] primers for PCR? are these primers effective in the genetic barcoding of Earthworms?

More Mahmoud Nabawy's questions See All

What is the indication of the absence of peaks in Methanol electrooxidation CV curves ?

I have several question regarding the MOR; hope anyone help me better understand. 1- in CV using (KOH+MEOH) what is the indication of absence of the redox peaks? shouldn't they exist as a sign...

28 February 2021 4,851 8 View

Is There are any idea to achieve H NMR signals for swollen compound ??

the samples are not completely soluble - just swelled the solvents that's mean the sample may be partially soluble any suggestion, please

16 February 2021 8,801 3 View

What is the best way to do symmetry in ANSYS Fluent for flow between two concentric cylinders ?

I am working on Taylor Couette flow between concentric cylinders and the results are correct for the full case. however, I wanted to do symmetry case to improve the mesh. I have tried periodic...

11 February 2021 2,193 6 View

What is the success rate of the e-learning plan in achieving the objectives of the curricula?

I need to know the reliability of the evaluation results and the rate of achievement of the course objectives, Thank you (*-*).

02 February 2021 7,828 7 View

What is the success rate of the e-learning program in your country during the time of Covid-19?

I need to know the extent of the success of the e-learning plan in countries of different capabilities, Thank you (*-*)

02 February 2021 4,712 15 View

How can I get good bands by silver nitrate staining on SSCP method?

Hi Dear colleagues This was my first experience on SSCP, and I couldn`t get any band by silver staining! Staining with Et Br was successful. I mixed the PCR product with formamide loading dye,...

01 February 2021 8,788 6 View

Why Selenium nanoparticles synthesized by PEG 200 could not be scaled up ?

I could not synthesize Selenium nanoparticles by PEG 200 at up-scale ( more than 100 ml) as it got aggregated while at small amounts it works fine , I work with 850 PPM using selenium powder in...

08 January 2021 10,049 1 View

Solving a third order polynomial matrix equation?

I want to solve the following matrix equation with respect to the matrix variable X which is a real symmetric positive definite matrix. The given matrix A is real and symmetric, "a" is a scalar,...

04 January 2021 2,945 7 View

What is the best method to add nanoparticles in organic solar cell simulation using silvaco software ??

i built the structure of the organic solar cell (ito-P3HT_PCPM-PEDOT_PSS-al) then i used BEAM statement to add sunlight so what is the best method to add nanoparticles in layers

03 January 2021 7,107 11 View

How to Calculate Local and Average NUSSELT NUMBER IN FLUENT ANSYS ?

I am simulating a single flow in a 2D tube with a uniform heat flux applying on the outer surface. I found difficulties finding the Nusselt Number or in other words a correct way to obtain...

26 December 2020 4,054 7 View

In PRIMER, is it possible to downweight certain taxa in multivariate community datasets to reflect uncertainty around identification??

I have a dataset with about 80 different species. As usual, some species are very easy to identify with certainty whereas others are more difficult, which means that I am less certain of my...

03 March 2021 8,066 4 View

How do I increase the yield of my PCR product?

Hello, We would like to increase the yield of our PCR product. We are running a series of PCR reactions that is targeting ~1.1kb sequence. We begin each reaction with ~400pg of template DNA...

02 March 2021 4,029 3 View

PACYC PCR not working after several attempts. Would anyone have any suggestions?

So, I have been trying to run a pACYC PCR which will be used later on for a Gibson Assembly. However the PCR is not working. I have already tried gradient PCR and changing extension time; however...

02 March 2021 1,146 2 View

Does anyone know HRM channel in a 2 plex QIAGEN Rotor- Gene Q qPCR can be used as a separate channel?

I am going to have 3 different probes in my qPCR work that I am going to do. But I realized that the machine we have in the lab is a Rotor-Gene Q 2plex HRM Platform, saying it has green, yellow,...

01 March 2021 8,544 1 View

How to calculate the annealing temperature of a primer pair?

I have to amplify a gene and my primers just reached. The Tm for Forward primer is 64.2, and that of reverse primer is 65.5. Can some one suggest how to get the best annealing temperature? Thanks...

01 March 2021 360 7 View

How to address this issue in the analysis of Real-Time PCR results?

To dear Researchers, I was analyzing a series of concentration for estimation of Real-Time PCR efficiency. The concentration was 1:10. I used MS-excel to evaluate Slope. The result of slope was -8...

01 March 2021 8,683 4 View

No title

Does anyone have the experience of using Taq Man probes in the QIAGEN Rotar- Gene qPCR machine?

01 March 2021 5,311 1 View

Anybody with an idea on how do design specific primers for detecting tomato resistance genes tm-1, TM-2 and Tm2^2?

I am trying to identify these 3 genes among some tomato cultivar collections and after aligning some sequences from NCBI, I couldn't find unique sequences to target for specific primers. There...

28 February 2021 606 3 View

What is the ideal efficiency for a qPCR?

hello everyone, I need to do standard curves for my qPCR, what is the ideal efficiency range? I tried a primer (Mglu2 receptor) that gave an efficiency of 90.2%. Is it accepted?

28 February 2021 1,254 3 View

MiRNA qpcr problem?

Dear All, mirna primer showing some problem in the melting curve? any idea why? As attached is the melting curve. The forward sequence is obtained from miRBase and reverse primer is universal.

28 February 2021 5,008 4 View

Csaba Csuzdi

This universal primer pair works fine with earthworms (at least in Lumbricidae).

Mahmoud Nabawy

Thanks a lot Dr Csaba Csuzdi.

Can you please, if you don't mind, advise me by a commercial product brand for these primers?

best regards

Daniel Fernandez Marchan

Hi Mahmoud.

These primers work also fine in other earthworm families.

I recommend this brand https://www.sigmaaldrich.com/configurator/servlet/DesignCenter

You can order both LCO and HCO for around 24 €

Best regards

Svante Martinsson

The primers work well for most annelids. If for some reason you would have a group where they don't work you may try to replace HCO2198 with COI-E (TATACTTCTGGGTGTCCGAAGAATCA) sometimes this primer work better, but I don't think I have had any problems using LCO/HCO for various earthworm families

Thank you very much Dr Daniel,

Thanks a lot Dr Svante,

my greetings