Please look at the following attached picture and suggest the bacteria in the petriplate?

medium in the plate is Rhizobium medium used for isolation of Rhizobium.

07 August 2018 9,424 9 View

Please somebody send me what are the max. permissible limit of heavy metal in soil in india?

08 September 2015 8,915 0 View

Why when I incubate Pseudomonas in medium with cetrimide for 10 days do I get the following patterns?

31 December 2014 3,308 8 View

How can I resolve a band of more than 23kb size on agarose gel?

I am isolating Plasmid from bacteria which is more than 23kb in size. I am using 0.8% Agarose gel on 100V and lambda DNA as marker. I am always getting band at size of 23 kb. I also used supermix...

07 August 2014 7,936 5 View

How does FAME analysis of bacteria help in deciding the novelty of bacteria?

I did sequencing and identified my bacteria by blast in NCBI. I feel my bacteria is of novel strain. Will FAME analysis prove to be useful in deciding the novelty of my bacteria?

03 April 2014 8,307 3 View

What is the difference between Global Impact Factor and Universal Impact factor? Which one is more effective?

I am confused regarding the impact factor criteria of the journals.

01 February 2014 7,679 5 View

What is the difference between minimum inhibitory concentration (MIC) and maximum tolerable concentration (MTC)?

I have to determine MIC and MTC of heavy metals. What is the method to determine both?

09 October 2013 1,466 7 View

Can anyone please tell me the institution offering SEM service for bacterial sample in India?

I am interested for Electron microscopy for my Bacterial sample. I want information regarding the various institutions in india offering this service at reasonable rate.

05 June 2013 897 25 View

Can anyone help me to identify why did I get color change yellow from green in citrate utilization test?

some bacteria is giving the positive result as expected i.e. blue to green but some is giving color change to yellow from green. I taken care of pH while preparing the media. I am attaching the...

05 June 2013 6,396 9 View

Is primer VIC1 (5'TTCCCTCGCAGAGAAAACATC3') and VIC2 (5'CCTGGTTGATCAGGTCGATCT 3') from algD GDP mannose dehydrogenase gene specific for P. aeruginosa?

This primer gives 520bp amplified product.

04 May 2013 7,499 1 View

MD MOE RMSD

How to calculate the RMSD values for a MD simulation using MOE?

07 August 2021 0 0 View

MD MOE RMSD

How to calculate the RMSD values for a MD simulation using MOE?

07 August 2021 0 0 View

fatal error

When I tried to energy minimization my system, I got fatal error as below. Fatal error: Atomtype opls_116 not found Although I've already added this line: ; include water #include "oplsaa.ff/spc.itp" to [molecultype] directive in my topology.

16 June 2021 0 0 View

fatal error

When I tried to energy minimization my system, I got fatal error as below. Fatal error: Atomtype opls_116 not found Although I've already added this line: ; include water #include "oplsaa.ff/spc.itp" to [molecultype] directive in my topology.

16 June 2021 0 0 View

fatal error

When I tried to energy minimization my system, I got fatal error as below. Fatal error: Atomtype opls_116 not found Although I've already added this line: ; include water #include "oplsaa.ff/spc.itp" to [molecultype] directive in my topology.

16 June 2021 0 0 View

fatal error

When I tried to energy minimization my system, I got fatal error as below. Fatal error: Atomtype opls_116 not found Although I've already added this line: ; include water #include "oplsaa.ff/spc.itp" to [molecultype] directive in my topology.

16 June 2021 0 0 View

What kind of fluid could I use for a pitfall trap that also does not invalidate molecular testing?

Hi, I want to start testing pitfall trap to obtain ants samples, but I need to conduct molecular analysis on those insects. So, what kind of fluid can I use? Ethanol expires too early and I need...

03 March 2021 5,978 5 View

No title

02 March 2021 3,060 3 View

How to normalise data on OPM package from R Studio ?

Good afternoon, I recently used OmniLog from BIOLOG for my experimentations : I tested the metabolism of different strains on 2 types of plates. I have 16 strains of 3 different groups...

02 March 2021 3,584 1 View

How to repeat an operation on an atom selection for multiple times in PyMol?

Hi, I am trying to construct a multi-layer fibril structure from a single layer in PyMol by translating the layer along the fibril axis. For now, I am able to use the Translate command in PyMol...

02 March 2021 4,569 4 View