.seq files are easily converted to fasta format in a text editor. Simply add a line before the sequence with the format: >sequence-id:

i.e.

>Sequence1

GGATGACCCGTGATAGTAGAAATTTATA

then concatenate your individual sequence files:

cat file1 file2 file3 ... filen > Multifasta.fa

For a novice, .ab1 files are most converted to .fasta (or .seq) using a software tool such as 4Peaks (free). The sequence can also be extracted from the fasta using the command line:

strings filename.ab1

The sequence can be found by scrolling up through the resulting output.

The above can be easily scripted (automated) if you know the format of the line that precedes the sequence line in the .ab1 file.

Wow, that looks rather straightforward enough, thanks a million. But I'm confused about something:

then concatenate your individual sequence files:

cat file1 file2 file3 ... filen > Multifasta.fa

Am I executing these commands in the text editor?

Thanks for being so helpful.

Those commands are executed in the unix\linux command line terminal:

1. Open the files in the text editor (make sure its an ASCI editor - i.e. not Word, textedit, etc.) and add the header lines.

2. Save the files.

3. Open a terminal window.

4. Change to the directory that contains the files (cd directory-name).

5. Issue the cat... command (or cat *.seq > outfile.fasta will concatenate all the files ending in .seq)

This is very explanatory. I will try the steps out soonest. You have my utmost thanks.

see this link to convert your file

http://sing.ei.uvigo.es/ALTER/