I am assembling several pCAGEN vectors, and I want to design a set of primers to measure expression of mRNA from the pCAG promoter. My initial strategy has been to design primers flanking the Chicken Beta Actin intron in the pCAG promoter, but these give high CTs and very unusual melt curves.
I designed two reverse primers due to the limited quality of the available priming sites, which are below:
(F: GGCCCTATAAAAAGCGAAGC | R1: CACAATAACCAGCACGTTGC | R2: GCACAATAACCAGCACGTTG | Expected mature amplicon size ~120bp)
I'm aware that I could design primers to target the 5' or 3' ends of my inserts, but I'd prefer to use a single set of primers for all three vectors.
Does anyone know of published and validated primers for measuring expression from pCAGEN that don't rely on insert sequence?
Alternatley, can anyone hazard a guess why my qPCR is not working? A separate Beta Actin qPCR worked as expected for the samples analyzed with the above primers.
(https://www.addgene.org/11160/)
May as well give an update, though the project is concluded: We ended up designing primers that could detect the transgene expression at the 5', 3' and internal regions of each transgene cDNA. Since all of the transgenes had the same c-terminal tag, we had several primers that would work for all three transgenes. We never developed a 'good' set of primers flanking the intron.
- Badges
- Science method